SUPPLEMENTARY DATA - MATERIALS AND METHODS
Construction of pZS*1-pR'WT-lacZ and its derivatives: The wild-type (wt) 
pR' region was obtained from the plasmid pS105cmycRlacZ (WANG et al. 2003) with a
double digestion of HindIII and EcoRI. The resulting 820-bp fragment was ligated with
the plasmid pZS*12-lacZ (created by replacing the luc gene of pZS*12-luc (LUTZ and
BUJARD 1997) with the lacZ gene from Escherichia coli (unpublished result)) that has
been double-digested with XhoI and EcoRI to replace its placO operator region. (The
XhoI end was blunted with T4 DNA polymerase and ligated with blunted HindIII end.)
The resulting plasmid, pZS*1-pR'WT-lacZ, contains the wt  pR' which controls the
expression of lacZ gene.
To create plasmids carrying various mutant pR' sequences, QuickChange sitedirected mutagenesis PCR (Stratagene, La Jolla, CA) were performed using pZS*1pR’WT-lacZ as the template and primer sets containing the desired mutations (see Table
1 and Figure 3), resulting in pZS1*-pR'M1-lacZ to pZS1*-pR'M5-lacZ. The wt and
mutant pR' sequences are shown in Figure 3.
Construction of E. coli strains for the determination of phage  late promoter
activity: Bacterial strain IN158 was transformed with the plasmid containing wt (pZS*1pR’WT-lacZ) or mutant (from pZS*1-pR’M1-lacZ to pZS*1-pR’M5-lacZ) pR' plasmids,
resulting in bacterial strains SYP029, SYP030, SYP032, SYP033, SYP037, and SYP041
(see Figure 1).
Construction of  strains with mutant of pR': To facilitate the construction of 
strains carrying various pR' mutations, cam gene was PCR-amplified from pZA31-luc
(LUTZ and BUJARD 1997) with two primers (Cam_Top/Cam_Bot) carrying homologous
sequences upstream of the -35 and downstream of the -10 regions of the  pR'. The
resulting PCR product was used as a mega-primer in a second round of site-directed
mutagenesis PCR(GEISER et al. 2001), with pZS*1-pR'WT-lacZ as the template. The
resulting plasmid, pZS*1-Cam-lacZ, was then transformed into strain IN56. The
transformed cells were thermally induced (WANG 2006) and the lysate used to lysogenize
bacterial strain IN25 to create SYP021.
To construct  strains with mutant pR' sequences, SYP021 (MC4100[ cI857
pR'::cam) was transformed with each of the five plasmids carrying different mutant pR'
sequences (see above). Each transformed strain was thermally induced to promote
homologous recombination between the pR' region. Since the parental pR'::cam strain
could not form plaques, the observed plaques in the lysate were the result from the
recombination between sequences flanking the prophage cam gene and the mutant pR' on
the plasmid. The resulting recombinant phages were then used to lysogenize IN 25,
resulting in SYP026, SYP027, SYP028, SYP043, and SYP044 (see Table 1). The pR'
region of each lysogen was PCR-amplified and mutations were confirmed with DNA
sequencing.
Construction of  strains for competition experiment: To differentiate between
phage strains during competition experiments, the genetic marker lacZ, which encodes
the first 100 amino acid residues of E. coli's lacZ gene, was fused at the end of the R
genes from  strains carrying the wt or mutant pR' sequences. Details of lacZ marker
construction has been published elsewhere (SHAO and WANG 2008). Briefly, plasmid
pSwtRlacZblueRz, which contains the active version of the marker, was separately
transformed into lysogens SYP026, SYP027, SYP028, SYP043, and SYP044. After
thermal induction of these plasmid-carrying lysogens, lysates were plate on E. coli XL1Blue in the presence of IPTG and X-gal (Shao and Wang 2008). Blue plaques, the results
of homologous recombination, were picked from each plate. Lysogens (SYP097,
SYP098, SYP099, SYP100, ad SYP101) were then made from these recombinant phages.
In this study, all the pR' mutants are designated as the competing strains and carry the
lacZ+ marker, while the wt pR' phage is the standard strain and carries the lacZmarker.
LITERATURE CITED
GEISER, M., R. CEBÈ, D. DREWELLO and R. SCHMITZ, 2001 Integration of PCR fragments
at any specific site within cloning vectors without the use of restriction enzymes
and DNA ligase. BioTechniques 31: 88-90, 92.
LUTZ, R., and H. BUJARD, 1997 Independent and tight regulation of transcriptional units
in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory
elements. Nucleic Acids Res. 25: 1203-1210.
SHAO, Y., and I. N. WANG, 2008 Bacteriophage adsorption rate and optimal lysis time.
Genetics 180: 471-482.
WANG, I.-N., J. DEATON and R. YOUNG, 2003 Sizing the holin lesion with an endolysinβ-galactosidase fusion. J. Bacteriol. 185: 779-787.
WANG, I. N., 2006 Lysis timing and bacteriophage fitness. Genetics 172: 17-26.
SUPPLEMENTARY DATA - TABLE
Summplementary Table 1. Primers used in phage strain construction and DNA sequencing.
Primers
-35_G_to_A_Top
CGGCATGATATTAACTTATTGAATAAAATTGGG
this study
-35_G_to_A_Bot
CCCAATTTTATTCAATAAGTTAATATCATGCCG
this study
Per-35_Top
CGGCATGATATTGACATATTGAATAAAATTGGG
this study
Per-35_Bot
CCCAATTTTATTCAATATGTCAATATCATGCCG
this study
Per_-10_Top
GAATAAAATTGGGTATAATTGACTCAACGATGGG
this study
Per_-10_Bot
CCCATCGTTGAGTCAATTATACCCAATTTTATTC
this study
-35_AC_to_CA_Top CGGCATGATATTGCATTATTGAATAAAATTGGG
this study
-35_AC_to_CA_Bot
CCCAATTTTATTCAATAATGCAATATCATGCCG
this study
-10_A3_to_T_Top
GAATAAAATTGGGTAATTTTGACTCAACGATGGG
this study
-10_A3_to_T_Bot
CCCATCGTTGAGTCAAAATTACCCAATTTTATTC
this study
CGGATGGCAACATATTAACGGCATGAAATTACGC
Cam_Top
this study
CCCGCCCTGCC
CGAGCGAATTAACCCATCGTTGTGGCGAAAATGA
Cam_Bot
this study
GACGTTGATCG
SUPPLEMENTARY DATA - FIGURE
Supplementary Figure 1. Flowchart of phage  strain construction. The names of
plasmids and lysogen strains used in construction are shown. Solid lines denote the
construction/cloning events, while the dashed line the transformation events. Different
sets of isogenic strains were constructed for the purposes of promoter activity
determination, lysis time and burst size determination, and pairwise competition.