1
Supplementary material online
Expanded Materials and methods
Unless otherwise stated, the source of all materials is listed in reference.1 Endothelin-1, STO609 and calcium ionophore A23187 were obtained from Calbiochem. A-769662 was from
Tocris.
Ethics statement
All animal studies were approved by the Animal Research Committee of Université
catholique de Louvain (Approval ID: UCL/MD/2007/049) and were performed in agreement
with guidelines on animal experimentation at our institution (Université catholique de
Louvain). This study conforms to the Guide for the Care and Use of Laboratory Animals
published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).
AMPKα1 knockout (KO) mice were bred and genotyped, as described previously.2
Isolation and culture of adult cardiomyocytes and mesenchymal stem cells
Animals were anaesthetized with ketamine/xylazine (i.p., 80/10 mg/kg) and sacrificed by
cervical dislocation before removing tissues. Anaesthesia depth was monitored by limb
withdrawal using toe pinching. Cultured adult cardiomyocytes were processed from male
Wistar rats.1 Cultured mouse MSCs were prepared according to a protocol designed for rat
MSCs.3 Briefly, 6-8-week-old mice were killed by cervical dislocation. Their bone marrow
was extruded from tibias and femurs in DMEM (Dulbecco’s modified Eagle’s medium) by
syringe. Bone marrow cells were washed and filtered on 100-µm mesh (Falcon), plated in
culture medium (DMEM supplemented with 10% fetal bovine serum, streptomycin and
penicillin), then incubated at 37°C in a humidified atmosphere containing 5% CO2. Non-
2
adherent cells were removed daily by medium replacement. After 10-15 days, a confluent
spindle-shape and fibroblast-like population of MSCs was obtained. Mouse MSCs were subcultured and used until passage 20.
The quality of MSC preparations was evaluated by measuring the expression of heightdifferent surface antigens by immunofluorescence microscopy and/or by fluorescenceactivated cell sorting analysis. For immunofluorescence studies, MSCs were fixed in 4%
paraformaldehyde and 0.2% triton X-100 (Sigma-Aldrich), washed, then incubated with
antibodies against either CD45 (BD Pharmingen) or CD90 (Cymbus Biotechnology) surface
antigens. After washing and staining with Alexa Fluor 594 secondary antibody (Molecular
Probes), the cells were examined by fluorescence microscopy (BX60; Olympus). For FACS
analysis, 200,000 cells were collected in 100 µl of phosphate-buffered saline (PBS) and
incubated with antibodies directed against either CD45 (fluorescein isothiocyanate-FITC- rat
anti-mouse CD45; BD Biosciences), CD11b (phycoerythrin-PE- rat anti-mouse CD11b; BD
Biosciences), CD34 (FITC rat anti-mouse CD34; BD Biosciences), CD31 (FITC rat antimouse CD31; BD Biosciences), CD29 (FITC rat anti-mouse CD29; BD Biosciences), CD44
(PE rat anti-mouse CD44; BD Biosciences), or CD117 (PE rat anti-mouse CD117, BD
Biosciences) antigens for 30 min at 4°C. The cells were then washed with PBS, fixed in
CellFix (BD Biosciences) and analyzed with FACScan (BD Biosciences). Data were
generated with CELLQUEST software (BD Biosciences) and analyzed with FlowJo software
(Tree Star, Inc.). In agreement with recent literature4, our MSC preparations were positive for
CD29 and CD44, and negative for CD11b, CD45, CD34, CD31 and CD117.
The capacity of mouse MSCs to differentiate was also verified (Figure S1). An adipogenic
differentiation protocol was derived from reference.3 MSCs were first plated at a density of
20,000 cells/cm2 and incubated in culture medium until they reached 100% confluence. The
medium was then supplemented with 1 µM dexamethasone, 0.2 mM indomethacin, 10 µg/ml
3
insulin, and 0.5 mM isobutylxanthine (induction medium), and incubation was continued for
3 days. The induction medium was then replaced by maintenance medium (culture medium
supplemented with 10 µg/ml insulin) for 3 days. These 2 steps were repeated 5 times over a
30-day period. Adipogenic differentiation was confirmed by staining lipid droplets with Oil
red O (MP Biochemicals). Osteogenic differentiation was induced by maintaining cells plated
at a density of 3,000 cells/cm2 in complete medium supplemented with 0.1 µM
dexamethasone, 50 µM ascorbic acid, and 10 mM β-glycerophosphate.3 The cells were
incubated for a total of 3 weeks, the differentiation medium being replaced every 3 days.
After completion of osteogenic differentiation, von Kossa staining3 disclosed the presence of
calcium deposits between differentiated cells.
Cell treatment and lysis
Cells were treated as described in the Figure legends. Hypoxic conditions were created by
incubating the cells at 37°C in an airtight Plexiglas chamber (Billups Rothenberg) under 95%
N2/5% CO2 atmosphere. Oxygen level in the chamber was maintained around 0.5% (MAXO2
oxygen analyzer, Maxtec). For glucose deprivation conditions, MSCs were cultured in
absence of FBS and in DMEM free of glucose during 6h. After treatment, the medium was
removed, and the cells were lysed in ice-cold lysis buffer containing 50 mM HEPES (pH 7.5),
50 mM KF, 1 mM KPi, 5 mM EDTA, 5 mM EGTA, 15 mM β-mercaptoethanol, complete
protease inhibitor cocktail (Roche), 1 mM vanadate, and 1% (vol/vol) triton X-100. The
lysates were then centrifuged (10,000 g, 15 min, 4°C), and the supernatants stored at -80°C.
Detection and quantification of total and phosphorylated proteins
Protein levels of the different AMPK isoforms were measured on immunoblots with antiAMPKα1 and anti-AMPKα2 (Kinasource) and anti-AMPKβ1 (Epitomics) and AMPKβ2
4
(Cell Signaling) and anti-AMPKγ1 (Abcam) and anti-AMPKγ2 (Cell Signaling) antibodies.
The phosphorylation state of AMPK, ACC, Histone H3 and eEF2 was evaluated on
immunoblots with anti-phospho-Thr172 AMPKα, anti-phospho-Ser79 ACC, anti-phosphoThr389 p70S6K, anti-phospho-Thr56 eEF2, anti-phospho-Ser10 Histone H3 (Cell Signaling)
antibodies, respectively. Total AMPK, ACC, H3, p27 and eEF2 was verified by
immunoblotting with anti-pan-AMPKα, anti-ACC, anti-Histone H3, anti-p27 and anti-eEF2
(Cell Signaling) antibodies, respectively. Band intensities were quantified by scanning and
processing with the ImageJ program (1.33 for Mac OS X). Immunoblots were quantified after
normalization with internal loading control on the same gel after stripping (anti-eEF2 or antiactin, depending on molecular weight of the proteins studied). To exclude the possibility that
altered phosphorylation levels were due to changes in protein expression, we normalized
phosphorylation by quantification of the respective protein using an anti-total antibody (also
normalized with an adequate loading control) on another gel. Each immunoblot was delimited
by a solid rectangle. When present, vertical solid lines denote that samples were run on the
same gel but were not contiguous.
Metabolite concentrations
Lactate production was measured enzymatically in perchloric acid preparations of MSC
supernatants, as described previously.5 Adenine nucleotides were quantified by highperformance liquid chromatography in perchloric acid preparations of MSCs.6
Cell proliferation, cell cycle distribution, cell death and apoptosis
The proliferation capacity of MSCs was tested by direct DNA synthesis measurement via
EdU (Invitrogen) incorporation. EdU was quantified by FACScan in the presence or absence
of 1% FBS. Cell cycle analysis was performed by propidium iodide (20 µg/ml)-RNase A
5
(2mg) staining after fixation (ethanol, 70%, 2h). Labelled cells were quantified by FACScan.
MSC death and apoptosis were detected with the fluorescent AnnexinV-FITC apoptosis
detection Kit (Sigma) according to the manufacturer’s instructions. The cells were incubated
with 0.1 µg/ml of AnnexinV and 0.5 µg/ml PI for 10 min, and 10,000 cells were then assessed
by FACScan. In all cases, data were analyzed with FlowJo software. Necrotic adult
cardiomyocytes were labelled by incubation with 50 µM PI.7 The percentage of living cells
was calculated from the number of necrotic (labelled) and living (unlabelled) cells observed
by microscopy (1,500 cells per condition and in triplicate in each experiment).
Protein synthesis
Cells were incubated for 48 h with [14C]L-phenylalanine (0.75 μCi/ml) in the presence or
absence of A-769662. They were then lysed and incubated with 10% trichloroacetic acid for
20 min at 4°C to precipitate proteins. The precipitated material was neutralized with 100 mM
NaOH. Samples were precipitated a second time with 10% trichloroacetic acid for 20 min at
4°C. After re-suspension of protein pellets in formic acid, incorporated radioactivity was
measured by liquid scintillation.
RNA silencing experiments
MSCs were cultured in presence of FBS 10% and without antibiotics for 6h and then
transfected with 10 nM siRNA (Santa Cruz) by using RNAiMAX lipofectamine following
manufacturer’s instructions (Invitrogen). Cells were cultured for 48h to allow a maximal
inhibition of protein expression. Knock-down efficiency was assessed by immunoblotting.
Cell Fractionation
6
After treatment as mentioned in the figure legends, cells were collected and fractionation was
performed with NE-PER nuclear and cytoplasmic extraction reagents following
manufacturer’s instructions (Thermo Scientific). The isolated fractions were then analysed by
immunoblotting.
Quantitative PCR
Total mRNA was extracted from MSCs with Tripure (Roche). First-strand cDNA was
prepared with oligo-dT priming, and 1 µg per reaction subsequently served as template for
quantitative PCR (qPCR) with SYBERGREEN® technology on a IQ5 sequence detection
system (Biorad). mRNA levels were expressed relative to glyceraldehyde 3-phosphate
dehydrogenase (GAPDH) used as housekeeping gene and were represented in fold increase
(treated vs. control MSCs). Relative changes in the target gene-to-GADPH mRNA ratio were
determined according to the formula 2-ΔΔCt. The primer sequences were (5' to 3'): p21:
CGAGAACGGTGGAACTTTGACTT and GTAGACCTTGGGCAGTAG, Cyclin D1:
TTCCAGAGTCATCAAGTGTGACC
GATGTCCTATCTGAGCATCG
and
and
GACCAGCCTCTTCCTCCACT,
GCTCCACATACTGGAAGCACT,
Glut1:
iPFK2:
ATTGGTCTGGCAACTGCAAA and GGAGCCTCCTATGTGTGAC, PGC1α:
ATACCGCAAGAGCACGAGAAG
and
CTCAAGAGCAGCGAAAGCGTCACAG,
mtTFA: GCTGATGGGTATGGAGAAG and GAGCCGAATCATCCTTTGCA, GAPDH:
GCCTCAACGACCCCTTCAT and ATGTTTGTGATGGGTGTGAA.
Seahorse flux analysis
A XF96 Seahorse Bioanalyzer (Seahorse Bioscience, Copenhagen, Denmark) was used to
measure cellular oxygen consumption rate (OCR). Cells were seeded in a Seahorse XF96
plate and treated for the indicated days. At the time of the analysis, cells were equilibrated in
unbuffered assay media (DMEM D5030, Sigma-Aldrich) supplemented with glucose (10
7
mM) and glutamine (4 mM), and assayed using the mitoStress kit (Seahorse) following
supplier’s protocol with oligomycin (1µM), FCCP (0.9 µM), antimycin (1 µM) and rotenone
(1 µM). Mitochondrial OCR (mtOCR) was calculated as the difference between basal OCR
and non-mitochondrial OCR (in the presence of rotenone and antimycin), with values
normalized for total protein content in cells.
Protein measurement and statistics
Protein content was estimated by the Bradford method with bovine serum albumin as a
standard. The results are expressed as means±SE. Statistical significance was calculated by 2tailed unpaired student’s t test and 1-way analysis of variance with the Bonferroni post hoc
test for simple and multiple comparisons, respectively.
References
1.
Bertrand L, Ginion A, Beauloye C, Hebert AD, Guigas B, Hue L, et al. AMPK
activation restores the stimulation of glucose uptake in an in vitro model of insulinresistant cardiomyocytes via the activation of protein kinase B. Am J Physiol Heart
Circ Physiol 2006;291:H239-H250.
2.
Jorgensen SB, Viollet B, Andreelli F, Frosig C, Birk JB, Schjerling P, et al. Knockout
of the alpha2 but not alpha1 5'-AMP-activated protein kinase isoform abolishes 5aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside but not contraction-induced
glucose uptake in skeletal muscle. J Biol Chem 2004;279:1070-1079.
3.
Roelants V, Labar D, de Meester C, Havaux X, Tabilio A, Gambhir SS, et al.
Comparison between adenoviral and retroviral vectors for the transduction of the
thymidine kinase PET reporter gene in rat mesenchymal stem cells. J Nucl Med
2008;49:1836-1844.
8
4.
Kolf CM, Cho E, Tuan RS. Mesenchymal stromal cells. Biology of adult
mesenchymal stem cells: regulation of niche, self-renewal and differentiation.
Arthritis Res Ther 2007;9:204.
5.
Zarrinpashneh E, Carjaval K, Beauloye C, Ginion A, Mateo P, Pouleur AC, et al. Role
of the alpha2-isoform of AMP-activated protein kinase in the metabolic response of
the heart to no-flow ischemia. Am J Physiol Heart Circ Physiol 2006;291:H2875H2883.
6.
Vincent MF, Marangos PJ, Gruber HE, Van den Berghe G. Inhibition by AICA
riboside of gluconeogenesis in isolated rat hepatocytes. Diabetes 1991;40:1259-1266.
7.
Balteau M, Tajeddine N, de Meester C, Ginion A, Des Rosiers C, Brady NR, et al.
NADPH oxidase activation by hyperglycemia in cardiomyocytes is independent of
glucose metabolism but requires SGLT1. Cardiovasc Res 2011;92:237-246.
9
Supplementary figures
Figure S1. Phenotypic characterization of MSCs. A: Adipocyte differentiation assay with
Oil red O staining. B: Osteogenic differentiation assay with von Kossa staining. Arrows
indicate characteristic differentiated MSCs.
10
Figure S2. AMPK subunit expression in WT and AMPKα1KO-derived MSCs. C+
(control) represents mouse heart extracts.
Figure S3. AMP/ATP ratio in MSCs treated with phenformin and oligomycin. MSCs
were untreated or incubated with phenformin (0.5 mM) for 2 h or oligomycin (1 µM) for 1 h.
High performance liquid chromatrography was performed on perchloric MSC extracts.
Values are means ± SE of 6 different samples.
11
Figure S4. Effect of glucose deprivation on cell survival (A), AMP/ATP ratio (B) and
AMPK activation (C-D) in MSCs. Cells were incubated with or without glucose during 6h.
A. Cells survival was evaluated after 6h of glucose deprivation. B. High performance liquid
chromatography was performed on perchloric MSC extracts. C-D. MSCs lysates were
analysed by immunoblotting of phosphorylated ACC (C) and AMPK (D). Values are relative
to untreated cells. In all cases, values are means±SE of at least 3 different experiments.
P<0.05.
12
Figure S5. Effect of A-769662 treatment on cell cycle in WT MSCs. MSCs were incubated
with 12.5 µM of A-769662 for 48 h. Values are represented as percent of cells in comparison
to control and are means±SE of 3 different experiments. P<0.05.
Figure S6. Effect of A-769662 treatment on death of WT and AMPKα1KO-derived
MSCs. Death was evaluated on MSCs incubated with various concentrations of A-769662 for
48h in WT (left) and AMPKα1KO-derived MSCs (right). Values are means±SE of at least 3
different experiments. P<0.05.
13
Figure S7. Effect of A-769662 treatment on protein synthesis in WT MSCs. MSCs were
incubated with various concentrations of A-769662 for 48 h. Protein synthesis was evaluated
after 48-h exposure to [C14]L-phenylalanine (0.75 µCi/ml). Values are relative to untreated
cells and are means±SE of at least 3 different experiments. P<0.05.
14
Figure S8. Effect of siRNA-mediated p27 silencing on A-769662 action on p27 expression
and ACC phosphorylation (A) and effect of A-769662 on p27 cellular localisation in WT
and AMPKα1KO-derived MSCs (B).
A. WT MSCs were transfected with a control peptide (scramble) or p27 siRNA during 48h
and then cells were treated with 12.5 µM of A-769662 for an additional period of 24h.
Lysates were analysed by immunoblotting total p27 and phosphorylated ACC. eEF2 served as
loading control and was evaluated on the same blot after stripping. The blots are
representative of at least 3 different experiments. As for untransfected MSCs (Fig. 5D), total
p27 was increased by A-769662 after scramble transfection. This increase disappeared after
p27 siRNA transfection. The A-769662-mediated AMPK activation (followed by ACC
phosphorylation) was maintained in both transfection conditions.
B. WT and AMPKα1KO-derived MSCs were incubated with 12.5 µM of A-769662 for 24h.
Cells were collected for cytoplasmic and nuclear fractionation and then lysates were analysed
15
by immunoblotting total p27. Values are relative to respective untreated cells and are
means±SE of at least 3 different experiments. P<0.05.
Figure S9. Effects of A-769662 treatment on the mitochondrial oxygen consumption
(mtOCR) of MSCs. Cells were treated with 25 µM of A-769662 during 5 days; n= 8. MSCs
were assayed using the mitoStress kit (Seahorse) with 1 µM oligomycin (A), 0.9 µM FCCP
(B), 1 µM antimycin and 1 µM rotenone (C). Values are shown as means±SE and are
representative of 3 independent experiments.