Online-Only Appendix
Experiment 2c – Harvesting of nervous tissues during and following intranasal
and subcutaneous insulin delivery studies
Following 1, 2, 4, 6 or 8 months of diabetes, mice from each cohort were sacrificed
using pentobarbital intraperitoneal injections. A total of 0.5 ml of whole intracardiac
blood was obtained for glycated hemoglobin measurements to be performed with affinity
chromatography (Procedure 422; Sigma Diagnostics) , which measures all glycated
hemoglobin and not just HbA1C.13 The following tissues were harvested: lumbar spinal
cord, bilateral L3-L6 dorsal root ganglia, sciatic nerves, sural nerves, and hind and fore
footpads. Blood for glycated hemoglobin measurements was taken prior to sacrifice.
One half of all tissues were fixed in cacodylate buffered glutaraldehyde, then cacodylate
buffer for later epon embedding for morphometric studies. The remaining tissues were
o
immediately fresh frozen at -80 C or placed in Trizol (Invitrogen, Burlington, ON) and
o
stored at -80 C.
Experiment 2d –Quantitative morphometry of peripheral nerve and DRGs
For peripheral nerve and dorsal root ganglia (DRG) specimens, samples were
embedded in epon, cut by ultramicrotome at 1 µm and stained with 0.5% toluidine blue
as previously described using stereological optical dissector techniques.13 Image
analysis was performed by a single examiner blinded to the origin of the sections (Zeiss
Axioskope at 400X and 1000x magnification using Scion Image v.4.0.2 (Scion Inc.,
Fredrick, MD, USA) with measurements of the number, axonal area, and myelin
thickness of all myelinated fibers within twenty-five non-adjacent transverse nerve
sections from 5-6 mice in each cohort (this was selected based upon a sample size
calculation using a 5% margin of error, 95% confidence level, and estimated 10% loss
of axonal fibers based upon prior work in the diabetic murine model 13,49). For DRGs,
neurons with visible nuclei were used for counting within a sized area for 25 nonadjacent sections separated by approximately 300 m for each L4-6 DRG for neuronal
density and total neuronal counts, again based upon similar sample size
measurements. All measurements of both nerve and DRG morphometry were
performed using Scion Image v.4.0.2 (Scion Inc., Fredrick, MD).
Experiment 2e – Epidermal innervation
Epidermal foot pads from both hindfeet and forefeet were fixed in 2%
Zamboni’s fixative overnight at 4°C, washed in PBS, kept overnight in 20% glucose
PBS solution, embedded in OCT embedding solution, and stored at -80°C until
sectioning. Thirty µm sections were prepared using a cryostat, and samples were
placed onto poly-L-lysine- and acetone-coated slides. Immunohistochemistry within foot
pads was performed using the panaxonal marker PGP 9.5 to identify all epidermal
axons (anti-mouse PGP 9.5 antibody (1:500, Jackson ImmunoResearch Laboratories,
West Grove, PA; and secondary antibody (anti-goat IgG FITC, 1:100, Chemicon Int.,
Temecula, CA)). Analysis of epidermal fibres within foot pads was performed as
described previously.18 Quantification was performed with two methods: 1) area
densities identifying epidermal nerve fibres extending above the dermal papillae
quantified per square millimeter of epidermal area; 2) linear densities calculating the
number of fibres within a length of each microsection expressed as a function of
epidermal length. A Zeiss fluorescent microscope with digital photography was used
along with Adobe Photoshop (Adobe Photoshop 9.0, Adobe, San Jose, CA, USA, 2005)
for analysis. For each animal, the number of PGP 9.5-immunoreactive profiles was
counted by a single observer blinded to the source of each specimen in each of the 30
μm thick microsections, which were performed through the entire footpad. A minimum of
200 microsections was examined in each case within each cohort, based upon sample
size calculations as described above.
In some cases, confocal microscopy (Nikon Inc., Melville, NY) was performed for
images to be demonstrated. Confocal images were obtained at heights of 1 μm at 20
adjacent levels in order to produce a fused image using Adobe Photoshop (Adobe
Photoshop 7.0). A final image was achieved by overlaying confocal images obtained for
PGP 9.5 and collagen type IV (1:100; Chemicon International, Temecula, CA, USA, and
secondary antibody anti-donkey IgG Cy3, 1:100, Chemicon Int., Temecula, CA).
Experiment 2f –Western Immunoblotting
Tissue portions were homogenized using a RotorStator Homogenizer in ice-cold
lysis buffer (10% glycerol, 2% SDS, 25mM Tris-HCl, pH7.4, Roche Mini-Complete
Protease Inhibitors). Samples were then centrifuged at 10,000G for 15 minutes and
equal amounts (15 µg) of protein were separated by SDS-PAGE using 10%
polyacrylamide gels under conditions previously described.13
Blots were probed with PI3K (1:1000), PKB/Akt (1:1000), and pAkt (1:1000). The
nuclear signaling transcription factor NFkB p65 and p50 subunits (1:1000 each) were
also examined, and additional immunohistochemistry was performed for CREB (1:200,
Abcam Inc., Cambridge, MA) and GSK3β (1:200, Abcam Inc., Cambridge, MA). For
housekeeping, anti-β-actin (1:100, Biogenesis Ltd. Poole, UK) was applied to separate
blots. Secondary anti-rabbit, anti-mouse, or anti-human IgG HRP Linked antibody (Cell
Signaling) was applied at 1:5000 in each case as appropriate. Signal detection was
performed by exposing of the blot to enhanced chemi-luminescent reagents ECL
(Amersham) for two minutes. The blots were subsequently exposed and captured on
Kodac X-OMAT K film. In each case, three blots were performed from different
composites of mice, and analyzed with Adobe Photoshop (Adobe Photoshop 9.0,
Adobe, San Jose, CA, 2005) for semi-quantification of blotting density.
Experiment 2g –mRNA Quantification
Total RNA was extracted from peripheral nerve and DRG using Trizol reagent
(Invitrogen). Total RNA (1 µg) was processed directly to cDNA synthesis using the
®
Superscript II Reverse Transcriptase system (Invitrogen). PI3K primers sequences
were: Forward
5'-AACCCGGCACTGTGCATAAA-3,
Reverse
5'GCCCATTGGATTAGCATTGATG-3'. Akt primers sequences were: Forward 5'TCTGCCCTGGACTACTTGCACT-3', Reverse 5'-GCCCGAAGTCCGTTATCTTGA-3'.
NFκBp65 primers sequences were: Forward, 5’- TGTGCGACAAGGTGCAGAAA -3’;
and Reverse, 5’- ACAATGGCCACTTGCCGAT -3’. β–actin primers sequences were:
Forward,
5’-TGTTGTCCCTGTATGCCTCTGGTC-3’;
Reverse,
5’ATGTCACGCACGATTTCCCTCTCTC-3’.
RT-PCR was done using SYBR Green dye. All reactions were performed in
triplicate in an ABI PRISM 7000 Sequence Detection System. Data were calculated by
-∆∆CT
the 2
method and are presented as the fold induction of mRNA for RAGE in diabetic
tissues normalized to, β–actin compared to non-diabetic tissues (defined as 1.0-fold).
Experiment 2h – Electrophoretic Mobility Shift Assay Quantification
For evaluation of CREB binding to DNA within lumbar dorsal root ganglia, nuclear
proteins were extracted with NE-PERTM Nuclear and Cytoplasmic Extraction Reagents
(Pierce, Rockford, IL). Protein–DNA complexes were detected using biotin end-labeled
double-stranded DNA probes prepared with the Biotin 3′ End DNA Labeling Kit (Pierce).
The binding probe used for CREB was 5'-ACGCTGC[[TGACGTCA]]GCAAAT-3’, with
the binding site indicated in square brackets. Electrophoretic mobility shift assay
(EMSA) was performed with a LightShift Chemiluminescent EMSA Kit (Pierce). Briefly,
nuclear extracts (10 μg protein) and the 10 × binding buffer with 2.5% glycerol, 5 mM
MgCl2, 50 ng/μL poly (dI-dC), 0.05% NP-40, 1 mM DTT, and 20 fmol biotin 3′-end
labeled double-stranded oligonucleotide were incubated at room temperature for 1 hour
in a volume of 20 μL. For CREB supershift analysis, an anti-CREB (Abcam Inc.,
Cambridge, MA; 1 μg per reaction) polyclonal antibody was incubated with the nuclear
proteins on ice for 1 hour before labeled oligonucleotide was added. Reaction products
were separated by electrophoresis (5% acrylamide [29:1 acryl/bis]) in 0.5 × TBE. After
electrophoresis, the protein–DNA complexes were transferred onto nylon membranes
and detected using chemiluminescence (LightShift kit; Pierce).
Supplementary Table 1 – Morphological properties of sciatic nerves in non-diabetic
and diabetic nerves from mice receiving intranasal or subcutaneous insulin or saline
after 8 months of diabetes
Physical Property
8 Months of Diabetes
2
Axonal fiber density (per mm )
Non-Diabetic I-I Mice (n=6)
15024 +/- 235
Non-Diabetic I-S Mice (n=6)
14793 +/- 241
Non-Diabetic S-I Mice (n=6)
14918 +/- 263
Non-Diabetic S-S Mice (n=6)
14714 +/- 221
Diabetic I-I Mice (n=5)
14622 +/- 369
Diabetic I-S Mice (n=4)
14606 +/- 376
Diabetic S-I Mice (n=5)
14607 +/- 291
Diabetic S-S Mice (n=5)
14598 +/- 302
2
Axonal area (µm )
Non-Diabetic I-I Mice (n=6)
38.3 +/- 0.5
Non-Diabetic I-S Mice (n=6)
37.7 +/- 0.6
Non-Diabetic S-I Mice (n=6)
38.2 +/- 0.6
Non-Diabetic S-S Mice (n=6)
37.9 +/- 0.4
Diabetic I-I Mice (n=5)
34.9 +/- 0.7*&
Diabetic I-S Mice (n=4)
31.7 +/- 0.6*
Diabetic S-I Mice (n=5)
32.9 +/- 0.7*
Diabetic S-S Mice (n=5)
31.6 +/- 0.6*
Myelination Thickness (µm)
Non-Diabetic I-I Mice (n=6)
1.08 +/- 0.04
Non-Diabetic I-S Mice (n=6)
1.03 +/- 0.03
Non-Diabetic S-I Mice (n=6)
1.09 +/- 0.04
Non-Diabetic S-S Mice (n=6)
1.02 +/- 0.04
Diabetic I-I Mice (n=5)
0.97 +/- 0.03*Φ
Diabetic I-S Mice (n=4)
0.89 +/- 0.04*
Diabetic S-I Mice (n=5)
0.94 +/- 0.05*
Diabetic S-S Mice (n=5)
0.90 +/- 0.06*
All measures are mean +/- SEM. * indicates significance at p<0.05 with comparison to
non-diabetic mice cohort groups;
diabetic cohort groups; and
Φ
&
indicates significance with comparison to other
indicates significance with comparison to S-S and I-S
diabetic cohort groups using multiple ANOVA testing with Bonferroni post-hoc t-test
comparisons (α=0.05, p<0.0125). (non-matched ANOVA tests, F-values range between
0.77-2.84 for indicated groups and time points, DF=4,3, n=4-6).
Supplementary Figure 1 – Morphological assessment of the sural and sciatic nerves
from diabetic and non-diabetic mice using semithin sections stained with toluidine blue.
Images of the sural nerve of a D I-S mouse (A), D I-I mouse (B), C I-S mouse (C), C I-I
mouse (D) are demonstrated. Axonal area histograms for sural nerves demonstrated a
leftward shift indicating axonal atrophy (E) (Tukey's Honestly Significant Difference Test,
* p<0.05, see Table 2 for mean values) for D I-S, D S-S and D S-I mice when compared
to each of the non-diabetic mouse cohorts, but not for D I-I mice. A more subtle, nonsignificant, leftward shift of diabetic mouse sciatic nerve axons was identified (F)
(Tukey's Honestly Significant Difference, p=NS, see Supplementary Table 1 for mean
values). Bar= 10 µm
Supplementary Figure 2 – Morphological assessment of the dorsal root ganglia (DRG)
from mice with and without diabetes using semithin sections and toluidine blue staining.
Diabetes was associated with greater age-dependent atrophy of DRG neurons (see
Supplementary Table 2). Images of a DRG of a D I-S mouse (A), D I-I mouse (B), C I-S
mouse (C), C I-I mouse (D) are demonstrated. An axonal area histogram for DRG
neuronal size demonstrates a leftward shift indicating neuronal atrophy for diabetic S-S
and S-I mice (E) (Tukey's Honestly Significant Difference Test, * p<0.05, see
Supplementary Table 2 for mean values), while D S-I and D I-I mice did not have
significant differences for histogram purposes when compared to non-diabetic mouse
cohorts. Bar=15 µm.
Supplementary Figure 3 – Quantification of CREB protein interaction with DNA
through EMSA revealed suppressed interaction in DRG from diabetic mice with partial
re-establishment in those receiving insulin delivery (A), greatest in the D I-I cohort (B).
Analysis was performed with multiple ANOVA tests, with * indicating significant
difference (p<0.0125) between groups indicated by horizontal bars(non-matched
ANOVA tests, F-values range between 1.44-5.76 for indicated groups and time points,
DF=2,3, n=3). All diabetic values were significantly less than non-diabetic values with
the exception of the D I-I cohort (significance not visually demonstrated).