SUPPLEMENTAL MATERIAL
I. Supplemental Methods
Reagents, Peptides, and Antibodies
Chenodeoxycholic acid (CDCA; obtained from Calbiochem, San Diego, CA) and GW4064
(obtained from TOCRIS Bioscience, Ellisville, MO), the natural and synthetic FXR agonists,
respectively, were reconstituted in dimethyl sulfoxide (DMSO) as 1,000× stock solution. The Z(trans) isomer of Guggulsterone, an FXR antagonist, was obtained from Steraloids Inc. (Newport,
RI). Cyclosporin A (CsA), MTT [3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide],
5-bromo-2’-deoxyuridine (BrdU), hydrogen peroxide (H2O2), N-t-butyl-α-phenylnitrone (PBN),
N-acetylcysteine (NAC), and 2,3,5-triphenyltetrazolium chloride (TTC) were from Sigma
Chemical Co. (St. Louis, MO). MTS [3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)2-(4-sulfophenyl)-2H-tetrazolium, inner salt] reagent was from Promega (Madison, WI). All
fluorescent dyes, including Hoechst 33258, Propidium iodide (PI), 4’-6-diamidino-2-phenylindole
(DAPI), MitoTracker Red, calcein-AM, and FITC-conjugated phalloidin were from Molecular
Probes (Eugene, OR). All products for cell culture were purchased from GIBCO BRL Co.
(Grand Island, NY).
To detect FXR, the following antibodies were used: goat polyclonal antibody against the Cterminus of FXR (C-20; sc-1204) was from Santa Cruz Biotechnology (San Diego, CA); mouse
monoclonal antibody against internal amino acids 2–126 of FXR/NR1H4 (clone PP-A9033A)
was from Invitrogen (Carlsbad, CA). Other antibodies and conjugates used were as follows: goat
anti-small heterodimer partner (SHP, Q-14; sc-15283), mouse anti-SHP(H-5; sc-271511), and
mouse anti–cytochrome c (2CYTC-199; sc-81752) was from Santa Cruz Biotechnology; rabbit
anti–BCL-2 (ab7973), rabbit anti-BAX (ab69643), mouse anti-cytochrome oxidase subunit IV
(anti-COX IV; ab14744), rabbit anti-Histone H3 (ab1791), mouse anti-heavy chain cardiac
Myosin (MHC; ab15), and mouse anti-vimentin (V9; ab8069) were from Abcam; mouse Nterminal epitope–specific anti-activated BAX monoclonal antibody (clone YTH-6A7; #2281MC-100) was from Trevigen (Gaithersburg, MD), rabbit anti-GAPDH (horseradish peroxidaseconjugate; #3683) and horseradish peroxidase–conjugated anti–mouse, –goat and –rabbit IgG
secondary antibodies were from Cell Signaling Technology (Beverly, MA); FITC-conjugated or
Alexa Fluor 488–conjugated anti–mouse, –goat and –rabbit IgG were from Molecular Probes.
The blocking peptide for FXR used in the study was sc-1204 P (Santa Cruz).
Cell Culture and In Vitro Experimental Protocols
Primary cultures of neonatal rat ventricular myocytes (NRVMs) were prepared as previously
described.1 Briefly, cells were isolated from hearts of 1–2-day-old Sprague-Dawley rats by trypsin
and collagenase digestion, purified by differential preplating, and maintained in DMEM with
10% (v/v) fetal bovine serum in a humidified incubator (37°C; 95% air + 5% CO2). BrdU (100
μmol/L) was added during the first 48 hours to reduce the background of non-myocytes. Cardiac
myocyte purity was monitored by immunofluorescence after double-staining with monoclonal
antibodies specific for cardiac MHC and Hoechst for total nuclei. This method may slightly
1
overestimate the total number of cells because a few of the cells are binucleated. Only cultures
consisting of >95% myocytes as determined 48 hours after plating were used for experiments
reported. Neonatal rat cardiac fibroblasts (NRCFs) were isolated by enzyme-digestion as
described above for myocytes, with removal of myocytes by selective attachment of
nonmyocytes to tissue culture dishes during the preplating procedure. Fibroblasts were grown in
DMEM supplemented with 10% (v/v) fetal bovine serum, and used for experiments within
three passages. As reported previously, purity of fibroblasts can be consistently maintained at
95% on the basis of positive immunostaining for vimentin and negative staining for cardiac
MHC and Von Willebrand factor.1 The H9c2 rat ventricular cells were obtained from American
Type Culture Collection (ATCC; Rockville, MD), and cultured by the method reported
previously.2 The Buffalo rat liver cells (BRL-3A), human hepatoma cell line (HepG2), and human
cholangiocarcinoma cell line (QBC939) were obtained from ATCC.3-5 In all experiments, cells
were rendered quiescent by serum starvation for 24 hours before treatment. For FXR ligand
experiments, cultures were treated with GW4064 or CDCA at the indicated concentrations for
various times. To dissolve the FXR ligands, DMSO (final concentration 0.1%) was present in the
buffer of all groups. In preliminary experiments, equivalent concentrations of DMSO showed no
measurable effects on apoptotic responses of cardiomyocytes. For hypoxia-reoxygenation (H/R)
experiments, the hypoxic condition was created by incubating the cells in an anaerobic chamber
equilibrated with 95% N2 plus 5% CO2 at 37°C for 6 hours. The cells were then reoxygenated
under normoxic conditions in a 95% air/5% CO2 humidified atmosphere at 37°C for the
indicated times. Normoxic control cells were incubated at 37°C in a 95% air/5% CO 2 only. For
the antioxidants study, PBN (10 mmol/L) or NAC (10 mmol/L) dissolved in DMSO were added
to cell cultures 1 hour before reoxygenation. In some experiments, cells exposed to H2O2 (0200μmol/L) for the indicated times.
Qualitative and Quantitative PCR
Total RNA was isolated from cells and tissues with TRIzol Reagent (Invitrogen) and purified
using Qiagen’s RNeasy Total RNA Isolation Kit. Real-time quantitative PCR (RTQ-PCR) was
performed using the ABI 7900HT Real-Time PCR System (Applied Biosystems, CA) and the
SYBR®Premix Ex TaqTM Perfect Real Time Kit essentially as described.6 SYBR Green real-time
PCR primers used were as follows: rat FXR (GenBank Accession No. NM021745), forward 5′CCAGGTCTCACTCAAGAATC-3′ and reverse 5′-GTCCCTAGCTCAGTTGACAA-3′, 150 bp;
rat SHP (GenBank Accession No. NM057133), forward 5′- ATCCTCCTCATGGCTTCCAC -3′
and reverse 5′- CCCATTCTACAGGTCACCTC -3′, 139 bp; rat GAPDH (GenBank Accession
No. NM017008), forward 5′- CACTGAGGACCAGGTTGTCT -3′ and reverse 5′TCCACCACCCTGTTGCTGTA-3′, 150 bp; mouse FXR (GenBank Accession No. NM009108),
forward
5′CACGAAGATCAGATTGCTTTGC
-3′
and
reverse
5′CCGCCGAACGAAGAAACAT-3′; mouse GAPDH (GenBank Accession No. BC083149),
forward
5′TGGCACAGTCAAGGCTGAGA
-3′
and
reverse
5′CTTCTGAGTGGCAGTGATGG -3′. The real-time PCR data were represented as Ct values,
defined as the crossing threshold of PCR using ABI7900 Data Analysis software. Relative
mRNA levels of the sample mRNA expression were calculated as described and expressed as 2 –
ΔΔCt 6
.
2
Cellular Fractionation and Western Blot Analysis
Proteins of cells or tissues were prepared according to the standard protocols,6-8 and protein
concentrations of lysates were determined using the Bradford assay (Bio-Rad, CA). To isolate the
mitochondrial and cytosolic fractions, cells were washed with PBS, using the
Mitochondria/Cytosol Fractionate Kit (BioVision, CA). For nuclear fractionation, the
Nuclear/Cytosol Fractionation Kit (BioVision, CA) was used. Equal quantities of proteins (30–
50 µg/lane) were submitted to 10 or 15% SDS-PAGE, depending of the target proteins,
electrotransferred onto polyvinylidene fluoride membranes, and then incubated with primary
antibodies against FXR (1:200), SHP (1:200), BAX (1:500), BCL-2 (1:500), cytochrome c (1:200),
COX IV (1:5000), H3(1:1000), or GAPDH (1:10000). After incubation with the corresponding
second antibodies, protein bands were detected using enhanced chemiluminescence (Pierce, IL),
and quantitation was performed using the Quantity One 4.4.0 software (Bio-Rad, CA).
Immunofluorescence Analysis
Confocal immunofluorescence was performed according to the well-established procedures as
described.2,8 In brief, cells on coverslips were fixed with 3.7% paraformaldehyde in PBS. To
identify the FXR protein, cells were stained with goat anti-FXR (C-20, 1:100), or mouse
monoclonal anti-FXR/NR1H4 (clone A9033A, 1:100). To analyze cytochrome c distribution,
unfixed live cells were first incubated with 10 nmol/L MitoTracker Red for 15 minutes to detect
respiring mitochondria, and then cells were fixed and further stained with mouse monoclonal
anti-cytochrome c (clone 2CYTC-199, 1:100). To determine the conformational activation of
BAX, cells were co-stained with the mitochondrial marker MitoTracker Red and monoclonal
conformation-specific anti-BAX (clone YTH-6A7, 1:300). The monoclonal 6A7 antibody
specifically recognizes an N-terminal epitope (residues 12–24) in BAX that is normally buried in
its native conformation but exposed in its active state and thus can be used to identify the
conformational rearrangement of this activation-specific epitope.9 After it reacted with
corresponding FITC-conjugated or Alexa Fluor 488–conjugated secondary antibody, DAPI (5
µmol/L) was added to visualize nuclei. Fluorescent images were examined under laser-scanning
confocal microscope (Leica TCS SP2, Leica Microsystems).
Quantification of Cell Viability by MTS and MTT Tests
Cell viability was evaluated with the MTS or MTT test. In our preliminary experiments, MTS test
appeared more reliable and repeatable for assessing cardiomyocyte viability compared with MTT
test. For the MTS test, cells were incubated with CellTiter 96®AQueous One MTS Solution
(Promega, WI) for 1 hour at 37°C, and the absorbance at 490 nm was recorded using an Elx800
Microplate Reader (BIO-TEK Instruments, Inc. VT). For the MTT test, cells were labeled with
MTT with a final concentration of 0.5 mg/ml for 4 hours at 37°C, and viability was then
evaluated by measuring the absorbance at 570 nm.
Detection of Nuclear Condensation by Hoechst Staining
To detect nuclear shrinkage as a late apoptotic event, cells were fixed with 4% paraformaldehyde,
incubated for 10 minutes with Hoechst 33258 (50 μmol/L). Myocyte sarcomeres were doublestained with FITC-labeled phalloidin and then observed under a confocal microscope.
3
Detection of Phosphatidylserine Translocation by Annexin V–FITC
Phosphatidylserine externalization, a relatively early event associated with the onset of apoptosis,
was assessed with an Annexin V-FITC Detection Kit (BD Biosciences Pharmingen, CA). Briefly,
cells were loaded with a saturating concentration of Annexin V–FITC for 15 minutes at 37°C,
and the apoptotic cells were counted by flow cytometry (FCM) on a FACScan (Becton
Dickinson, CA).
Flow-Cytometric Analysis of Apoptosis by JC-1 Labeling
Apoptotic cells were also assessed by FCM analysis using the MitoProbeTM JC-1 Apoptosis Assay
Kit (M34152, Molecular Probes) as described.2,10 Briefly, cells were loaded with 5 μmol/L JC-1
fluorescent probe at 37°C for 30 minutes followed by FCM analysis on a FACScan using
CellQuest Pro Software (Becton Dickinson).
Monitoring MPTP Opening by Calcein Loading/Co2+ Quenching
The activation of MPTP, a multi-protein channel in the inner membrane, was monitored directly
in intact cells using a well-characterized calcein-AM loading /Co2+ quenching technique by either
confocal microscopy or FCM analysis.11 For confocal microscopy, myocytes were loaded with 1
μmol/L calcein-AM in the dark at 37°C for 15 minutes, in the presence of 1 mmol/L cobalt
chloride (CoCl2) to quench the cytoplasmic and nuclear signals. This method allows for selective
loading of calcein (~622 Da) in mitochondria with closed MPTP in living cells. As a negative
control, cells were incubated in medium lacking the fluorescent dye. Cells underwent Ca 2+
overload (ionomycin, 1 μmol/L) was used as a positive control to indicate MPTP opening. Cells
were then washed, and the fluorescence was imaged by confocal microscopy. For flow cytometry
analysis, cells were collected and stained with 2 μM calcein-AM containing CoCl2 and ionomycin
when required at 37°C for 15 minutes. Calcein fluorescence intensity was quantified using the
MitoProbeTM Transition Pore Assay Kit (Molecular Probes) via the FACScan
(excitation/emission 494/517 nm) with the CellQuest Pro Software.
Measurement of Mitochondrial Membrane Potential (ΔΨm)
The assessment of ΔΨm was carried out by either confocal microscopy or FCM analysis with the
JC-1 Assay Kit (Molecular Probes). JC-1 red/green fluorescence intensity ratio is dependent only
on the mitochondrial membrane potential and not on other factors, such as mitochondrial size
and density, rendering JC-1 far more reliable than any other mitochondrial probe to evaluate
mitochondrial function.12 For FCM, cells were loaded with 5 μmol/L JC-1 in the dark for 30
minutes at 37°C, and the ΔΨm was measured from the JC-1 red/green fluorescence intensity
ratio via FACScan (excitation 488 nm, emission 530/575 nm). For confocal microscopy, cells on
coverslips were loaded with 10 μmol/L of JC-1 at 37°C for 15 minutes, and the fluorescence was
viewed by confocal microscopy.
Determination of Cytochrome c in Mitochondria and Cytosol by ELISA
Mitochondrial and cytosolic fractions from cells and tissues were prepared as described above.
The release of cytochrome c from the mitochondria was assessed by using the Quantikine®
Rat/Mouse Cytochrome c Immunoassay (R&D Systems Inc., MN) according to the
manufacturer’s instructions. Briefly, the sample and anti–rat cytochrome c conjugated to
4
horseradish peroxidase were added to microtiter wells coated with a monoclonal antibody
specific for rat cytochrome c. Cytochrome c levels were then determined by measuring the
absorbance at 450 nm using an ELx800 Microplate Reader.
Determination of Reactive Oxygen Species (ROS) Production
Intracellular ROS activity was measured using an OxiSelect™ ROS Assay Kit (Cell Biolabs Inc.,
San Diego, CA) according to the protocol provided by the manufacturer. The assay employs the
cell-permeable ROS-sensitive fluorogenic probe 2’, 7’-Dichlorodihydrofluorescin diacetate
(DCFH-DA). DCFH-DA enters the cell and is deacetylated by cellular esterases to nonfluorescent DCFH, which is rapidly oxidized to highly fluorescent compound DCF by ROS. For
fluorescence microscopy, cells on coverslips were loaded with H2DCF-DA with a final
concentration 10 μmol/L and incubated at 37°C for 30 min, and the DCF fluorescence was
detected with excitation at 488 nm.
In Vitro Gene Silencing with Small Interfering RNA (siRNA)
Predesigned HP GenomeWide siRNA targeting rat FXR (Rn_Nr1h4 HP siRNA; Cat.No.
SI03029117, SI03053316, and SI03097745) and SHP (Rn_Nr0b2 HP siRNA; Cat.No.
SI01921143, SI01921150, and SI01921157) were purchased from Qiagen GmbH (Hilden,
Germany).AllStars Negative Control siRNA (Qiagen, Cat. No. 1027280) was used as a negative
control. This validated non-silencing control has no homology to any known mammalian gene
and has been validated using Affymetrix GeneChips (Qiagen). Cells were transfected for 24
hours with FXR or SHP siRNA or non-silencing siRNA by using RNAiFect Transfection
Reagent (Qiagen) according to the manufacturer’s instructions. Preliminary experiments were
carried out to establish optimal transfection conditions. Mock-transfected cells were treated
identically except for the omission of siRNA. Experiments were performed 48 hours after
siRNA transfection.
Animal and In Vivo Experimental Protocols
In vivo experiments were performed on wild-type C57BL/6 and FXR-null male mice (Jackson
Laboratories, Bar Harbor, ME).Myocardial ischemia/ reperfusion (I/R) procedure was
performed as described in our previous studies.13,14 In brief, heart was manually exposed without
intubation through a small incision, and a slipknot was made around the left anterior descending
coronary artery (LAD) 2–3 mm from its origin with a 6–0 silk suture. Sham-operated animals
were subjected to the same surgical procedures except that the suture was passed under the LAD
but was not tied. Following 30 minutes of ischemia, the slipknot was released and the
myocardium was subjected to 3 hours (all assays except cardiac function and infarct size) or 24
hours (cardiac function and infarct size only) of reperfusion. For in vivo pharmacologic blocking
experiments, Z-Guggulsterone, a well-known antagonist for FXR, was used.15,16 Fifteen minutes
before reperfusion, animals were randomized to receive vehicle or Z-Guggulsterone (50-100
mg/kg; IP). Z-Guggulsterone at this dose was effective in inhibiting FXR activities in the in vivo
animal studies.15 For in vivo siRNA blocking experiments, myocardial I/R procedure were
performed 48 hours after intramyocardial siRNA delivery as described below.
5
In Vivo siRNA-mediated Cardiac-specific Gene Silencing
The in vivo siRNA gene silencing technique by intramyocardial delivery was utilized to knock
down cardiac-specific FXR expression as we described.17 In brief, three Stealth RNAi™ siRNA
targeting mouse FXR (Cat. No. MSS208760, MSS208761, and MSS208762; Invitrogen) or
Negative Control siRNA (Cat. No. 12935-200) were complexed with In Vivo JetPolyethylenimine (PEI™) Delivery Reagent (Genesee Scientific, San Diego, CA) in 5% glucose
according to the manufacturer’s recommendations.18,19 Mice were anesthetized with 2% isoflurane,
and the heart was exposed via a left thoracotomy at the fifth intercostal space. Mouse-specific
FXR siRNA or negative control (20 µl; 1 µg/g) was delivered via three separate intramyocardial
injections (32.5-gauge needle) to temporarily blanch the left ventricular free wall. Our pilot
experiments showed that cardiac FXR expression reaches a nadir of ~30% of control levels 48
hours after siRNA injection. Thus, myocardial I/R experiments were performed 48 hours after
intramyocardial siRNA delivery.
In-situ Detection of Apoptosis in Heart Tissue
Myocardial apoptosis was determined by terminal deoxynucleotidyl-transferase dUTP nick-end
labeling (TUNEL) technique using a Fluorescein In Situ Cell Death Detection Kit (Roche
Diagnostics, Indianapolis, IN) as described in our previous study.13, 14, 20 Cardiomyocytes were
identified by anti–α-actinin antibody (mouse; 1:800), total cardiomyocyte nuclei were labeled with
DAPI, and apoptotic nuclei were detected by green fluorescein staining.20
In Vivo Echocardiographic and Hemodynamic Measurements
In vivo cardiac function was determined by echocardiography as well as left ventricular (LV)
catheterization methods 24 hours after reperfusion before the chest was reopened as described.
13,14
For echocardiography, mice were anesthetized with a 1.5% isoflurane and two-dimensional
echocardiographic views of the mid-ventricular short axis were obtained at the level of the
papillary muscle tips below the mitral valve (Vevo 770, VisualSonic, Toronto, Canada). LV
fractional shortening (LVFS) and LV ejection fraction (LVEF) were calculated as previously
described.13,14 For hemodynamic measurements, the right common carotid artery of mice was
cannulated with 1.4 French micro-manometer (Millar Instruments, Houston, TX). LV systolic
pressure, LV end-diastolic pressure (LVEDP), maximal and minimum values of the
instantaneous first derivative of LV pressure (±dP/dtmax), aortic systolic blood pressure (SBP)
and diastolic blood pressure (DBP) , and heart rate (HR) were derived by computer algorithms
and analyzed on a PowerLab System (AD Instruments Pty Ltd., Mountain View, CA).
Determination of Myocardial Infarct Size
Myocardial infarct size was determined by Evans blue-TTC double staining methods as
described previously.13,14 Briefly, following 24 hours of reperfusion, the ligature around the
coronary artery was re-tied and 0.2 ml 2% Evans blue dye was injected into the left ventricular
cavity. The heart was then quickly excised, frozen with try ice and sliced into five 1.2 mm-thick
slices that were perpendicular to the long axis of the heart. The unstained portion of
myocardium (area at risk, AAR) was separated from the Evans blue-stained portion of the
6
myocardium (area not at risk, ANAR). The slides were then incubated in 1% TTC for 15 min
and then digitally photographed. The Evan’s blue–stained area (ANAR), TTC-stained area, and
TTC-negative staining area (infarcted myocardium) were measured using the computer-based
image analyzer SigmaScan Pro 5.0 (SPSS Science, Chicago, IL). Myocardial infarct size was
expressed as a percentage of the infarct area (I) over AAR (I/AAR) and the size of AAR was
expressed as the percentage of AAR over total LV area (AAR/AAR+ANAR) as described
previously.13,14
Statistical Analysis
Data are presented as mean ± SD. Statistical analyses were performed using SAS9.13 (SAS
Institute Inc., Cary, NC). The normality assumption was assessed by the Shapiro-Wilk test.
Statistical significance of multiple treatments was determined by one-way or two-way analysis of
variance (ANOVA) followed by the Bonferroni post hoc test when appropriate. Western blot
densities were analyzed with the Kruskal-Wallis test followed by Dunn’s post-hoc test.
Probabilities of 0.05 or less were considered to be statistically significant (2-tailed).
7
II. Supplemental Results
Effect of FXR activation on BCL-2/BAX Expression in cardiomyocyte
To gain detailed understanding of the signaling events involved in FXR-induced cardiomyocyte
apoptosis and mitochondrial dysfunction, we examined the effect of FXR agonists upon
expression of BCL-2 family proteins, which have been implicated as major regulators of
mitochondrial homeostasis in many cellular events. Figure S3A and B of Supplementary material
online illustrate the expression of pro-apoptotic BAX and the anti-apoptotic BCL-2 by Western
blot utilizing rabbit polyclonal antibodies against BCL-2 and BAX. A dramatic reduction of
BCL-2 protein levels was detected in a time-dependent manner after GW4064 exposure. In
contrast, we were unable to detect significant changes in BAX protein levels in the same samples.
The lack of upregulation of BAX protein prompted us to further investigate the subcellular
location of BAX in our system. For this analysis, we used a monoclonal conformation-specific
antibody [clone YTH-6A7 directly raised against sequences (CGPTSSEQIMKTGA) in the Nterminal epitope 12-24 of BAX] specifically recognizing BAX only in its N-terminal–exposed
active conformation, but not its native conformation.21 In untreated cells, anti-BAX 6A7 failed to
bind the native soluble cytosolic form of BAX and gave a negative staining (Supplementary
material online, Figure S3C, top), indicating that this epitope is normally buried. However, after
being subject to FXR agonists, the cells demonstrated a shift in the BAX fluorescence pattern to
a distinct punctuated mitochondrial membrane-bound state (Supplementary material online,
Figure S3C, bottom), indicating a membrane-integrated activated form of BAX. The appearance of
BAX immunoreactivity suggested the N-terminal region of the native protein underwent a
conformational change, rendering the hidden epitope accessible to antibodies. This change did
not require new protein synthesis in our system, as we failed to detect any upregulation of total
BAX protein. No mitochondrial staining was observed in negative control experiments when
primary antibody was replaced by normal mouse serum, confirming the specificity of the BAX
immunostaining. The mitochondrial redistribution of BAX was further confirmed by doublestaining with MitoTracker Red, showing a significant, although not complete, overlap with the
MitoTracker network (Supplementary material online, Figure S3C, bottom). The percentage of cells
demonstrating membrane-bound activated BAX, determined by evaluating the proportion of
BAX co-localizing with MitoTracker-labeled mitochondria, increased with treatment time
(Supplementary material online, Figure S3D, bottom).
Mechanism of mitochondrial apoptotic signaling activation by FXR activation: role of
SHP
SHP, the FXR direct target, has recently been identified as an active component of
mitochondrial apoptotic signaling and as a death receptor by directly targeting mitochondria,
where it binds and inactivates BCL-2, disrupting mitochondria, and activating mitochondrial
pathway-mediated apoptosis.22,23 Thus, we examined whether SHP plays an active role in FXRmediated mitochondrial disruption. Fractionation and Western blot analysis demonstrated that
SHP was barely observed in the mitochondrial fraction in control myocytes, and its accumulation
was significantly increased in the mitochondrial fraction after treatment with FXR agonists
(Supplementary material online, Figure S4). Thus, activation of FXR by its agonists induced the
translocation of SHP proteins to the mitochondria. To further determine whether SHP is
8
crucial in FXR agonist-induced mitochondrial disruption, cells were transfected with SHP
siRNA or AllStars negative siRNA (40 nmol/L SHP siRNA caused 74.7±16.4% reduction of
SHP expression, Supplementary material online, Figure S5A). Interestingly, gene silencing of
SHP blocked the activation of mitochondrial apoptotic signaling induced by FXR agonist in
NRVMs, as assessed by the measurement of MPTP, mitochondrial ΔΨm, cytochrome c release,
and caspase-9 and -3 activities (all P<0.05 versus scrambled siRNA-transfected cells,
Supplementary material online, Figure S5B-E), indicating this molecule is requisite for triggering
FXR-dependent mitochondrial disruption. Furthermore, transfection with SHP siRNA
efficiently inhibited the decline in BCL-2 expression and mitochondria-associated BAX
accumulation induced by FXR agonist (Supplementary material online, Figure S5F). Taken
together, these results suggest that SHP, the death receptor that targets mitochondria, mediates
the activation of mitochondrial apoptotic signaling induced by FXR.
9
III. Supplementary References
1. Gray MO, Long CS, Kalinyak JE, Li HT, Karliner JS. Angiotensin II stimulates cardiac
myocyte hypertrophy via paracrine release of TGF-beta 1 and endothelin-1 from fibroblasts.
Cardiovasc Res 1998;40:352-363.
2. Shan P, Pu J, Yuan A, Shen L, Shen L, Chai D, He B. RXR agonists inhibit oxidative stressinduced apoptosis in H9c2 rat ventricular cells. Biochem Biophys Res Commun 2008;375:628-633.
3.Nissley SP, Short PA, Rechler MM, Podskalny JM, Coon HG. Proliferation of buffalo rat liver
cells in serum-free medium does not depend upon multiplication-stimulating activity (MSA). Cell
1977;11:441-446.
4.Han P, Kang JH, Li HL, Hu SX, Lian HH, Qiu PP, Zhang J, Li WG, Chen QX.
Antiproliferation and apoptosis induced by tamoxifen in human bile duct carcinoma QBC939
cells via upregulated p53 expression. Biochem Biophys Res Commun 2009;385:251-256.
5. Komichi D, Tazuma S, Nishioka T, Hyogo H, Chayama K.A nuclear receptor ligand downregulates cytosolic phospholipase A2 expression to reduce bile acid-induced cyclooxygenase 2
activity in cholangiocytes: implications of anticarcinogenic action of farnesoid X receptor
agonists. Dig Dis Sc 2005;50:514-524.
6. Jiang LS, Pu J, Han ZH, Hu LH, He B. Role of activated endocannabinoid system in
regulation of cellular cholesterol metabolism in macrophages. Cardiovasc Res 2009;81:805-813.
7. Wang Y, Gao E, Tao L, Lau WB, Yuan Y, Goldstein BJ, Lopez BL, Christopher TA, Tian R,
Koch W, Ma XL. AMP-activated protein kinase deficiency enhances myocardial
ischemia/reperfusion injury but has minimal effect on the antioxidant/antinitrative protection of
adiponectin. Circulation 2009;119:835-844.
8. Chai D, Wang B, Shen L, Pu J, Zhang XK, He B. RXR agonists inhibit high-glucose-induced
oxidative stress by repressing PKC activity in human endothelial cells. Free Radic Biol Med
2008;44:1334-1347.
9. Peyerl FW, Dai S, Murphy GA, Crawford F, White J, Marrack P, Kappler JW. Elucidation of
some Bax conformational changes through crystallization of an antibody-peptide complex. Cell
Death Differ 2007;14:447-452.
10. Modrak DE, Cardillo TM, Newsome GA, Goldenberg DM, Gold DV. Synergistic interaction
between sphingomyelin and gemcitabine potentiates ceramide-mediated apoptosis in pancreatic
cancer. Cancer Res 2004;64:8405-8410.
11. Petronilli V, Penzo D, Scorrano L, Bernardi P, Di Lisa F. The mitochondrial permeability
transition, release of cytochrome c and cell death. Correlation with the duration of pore openings
in situ. J Biol Chem 2001;276:12030-12034.
12. Salvioli S, Ardizzoni A, Franceschi C, Cossarizza A. JC-1, but not DiOC6(3) or rhodamine
123, is a reliable fluorescent probe to assess ΔΨ changes in intact cells: implications for studies
on mitochondrial functionality during apoptosis. FEBS Lett 1997;411:77-82.
13. Gao E, Lei YH, Shang X, Huang ZM, Zuo L, Boucher M, Fan Q, Chuprun JK, Ma XL,
Koch WJ. A novel and efficient model of coronary artery ligation and myocardial infarction in
the mouse. Circ Res 2010;107:1445-1453.
14. Wang Y, Gao E, Tao L, Lau WB, Yuan Y, Goldstein BJ, Lopez BL, Christopher TA, Tian R,
Koch W, Ma XL. AMP-activated protein kinase deficiency enhances myocardial
10
ischemia/reperfusion injury but has minimal effect on the antioxidant/antinitrative protection of
adiponectin. Circulation 2009;119:835-844.
15. Urizar NL, Liverman AB, Dodds DT, Silva FV, Ordentlich P, Yan Y, Gonzalez FJ, Heyman
RA, Mangelsdorf DJ, Moore DD. A natural product that lowers cholesterol as an antagonist
ligand for FXR. Science 2002;296:1703-1706.
16. Wu J, Xia C, Meier J, Li S, Hu X, Lala DS. The hypolipidemic natural product guggulsterone
acts as an antagonist of the bile acid receptor. Mol Endocrinol 2002;16:1590-1597.
17. Wang Y, Lau WB, Gao E, Tao L, Yuan Y, Li R, Wang X, Koch WJ, Ma XL. Cardiomyocytederived adiponectin is biologically active in protecting against myocardial ischemia-reperfusion
injury. Am J Physiol Endocrinol Metab 2010;298:E663-670.
18. Cubillos-Ruiz JR, Engle X, Scarlett UK, Martinez D, Barber A, Elgueta R, Wang L, Nesbeth
Y, Durant Y, Gewirtz AT, Sentman CL, Kedl R, Conejo-Garcia JR. Polyethylenimine-based
siRNA nanocomplexes reprogram tumor-associated dendritic cells via TLR5 to elicit therapeutic
antitumor immunity. J Clin Invest 2009;119:2231-2244.
19. Song P, Wu Y, Xu J, Xie Z, Dong Y, Zhang M, Zou MH.Reactive nitrogen species induced
by hyperglycemia suppresses Akt signaling and triggers apoptosis by upregulating phosphatase
PTEN (phosphatase and tensin homologue deleted on chromosome 10) in an LKB1-dependent
manner. Circulation 2007;116:1585-1595.
20. Liang F, Gao E, Tao L, Liu H, Qu Y, Christopher TA, Lopez BL, Ma XL. Critical timing of
L-arginine treatment in post-ischemic myocardial apoptosis-role of NOS isoforms. Cardiovasc Res
2004;62:568-577.
21. Xin M, Deng X. Protein phosphatase 2A enhances the proapoptotic function of Bax through
dephosphorylation. J Biol Chem 2006;281:18859-18867.
22. Zhang Y, Soto J, Park K, Viswanath G, Kuwada S, Abel ED, Wang L. Nuclear receptor SHP,
a death receptor that targets mitochondria, induces apoptosis and inhibits tumor growth. Mol Cell
Biol 2010;30:1341-1356.
23. Farhana L, Dawson MI, Dannenberg JH, Xu L, Fontana JA. SHP and Sin3A expression are
essential for adamantyl-substituted retinoid-related molecule-mediated nuclear factor-kappaB
activation, c-Fos/c-Jun expression, and cellular apoptosis. Mol Cancer Ther 2009;8:1625-1635.
11
IV. Supplementary Figure legends
Figure S1. Effect of FXR activation upon cardiomyocyte viability.
Representative dose–response curves of NRVMs (A) and H9c2 ventricular cells (B) treated with
indicated doses of GW4064 (0-30 μmol/L) or CDCA (0-500 μmol/L) for 24 hours. Cellular
viability was determined by MTS assay with vehicle-treated cells defined as 100%. n=6–8 dishes
from at least 4 separate cultures.
Figure S2. Effect of FXR activation on early markers of apoptosis in cardiomyocytes.
NRVMs were treated with the indicated concentration of CDCA or GW4064 for 12 hours. Early
apoptosis was determined by Annexin V–FITC binding and JC-1 labeling methods.
Representative flow-cytometric histograms of Annexin-V binding (A) or JC-1 labeling (B) are
shown from 3-4 independent cultures, while quantitative data are represented by the bar graph
for Annexin-V binding (C) and JC-1 labeling (D). n=3-5 from at least 3 separate cultures, *
P<0.05, † P<0.01 vs vehicle-treated control.
Figure S3. Effect of FXR activation upon BCL-2/BAX expression in cardiomyocytes.
(A) Western blots for BCL-2 and BAX expression. NRVMs were incubated with GW4064 (5
μmol/L) for the indicated times and subjected to immunoblots using polyclonal anti-BCL-2 and
anti-BAX antibodies. (B) Densitometric analysis of BAX and BCL-2 levels, normalized to
GAPDH. Data are from three (BCL-2) or five (BAX) independent experiments. * P<0.05, †
P<0.01, vs vehicle-treated control. (C) Confocal images of NRVMs triple-stained with
monoclonal anti-6A7 epitope for activated BAX (green), MitoTracker for mitochondria (red),
and DAPI for nuclei (blue). Representative images shown are from NRVMs after 12 hours
incubation with GW4064 (5 μmol/L). Bar=10 μm. (D) Time-courses of conformational BAX
activation at the mitochondria after FXR agonist treatment. NRVMs were exposed to vehicle,
GW4064 (3 and 5μmol/L) or CDCA (75 and 100μmol/L). The percentage of cells showing
mitochondria-associated BAX is represented of 3–4 independent experiments for each time
point. * P<0.05, † P<0.01 compared to time-matched vehicle-treated control. (E) Effects of in
vitro FXR silencing on BCL-2/BAX expression in cardiomyocytes. NRVMs were transfected
with 20 nmol/L of FXR siRNA, AllStars negative siRNA, or mock-treated for 24 hours,
followed by GW4064 (5 μmol/L) treatment for 12 hours. DMSO-treated cells were used as
control. Representative Western blots for BCL-2 expression (Upper) shown are from three
independent experiments. The percentage of cells showing mitochondria-associated BAX
(Bottom) is represented of three independent experiments. * P<0.05, † P<0.01 compared to
vehicle-treated cells, ‡ P<0.05, § P<0.01 compared to GW4064-treated cells.
Figure S4. Mitochondrial translocation of SHP in NRVMs.
Western blot of SHP distribution was done on whole-cell, mitochondrial, and nuclear lysates
from NRVMs exposed to vehicle or GW4064 (5 μmol/L) for 12 hours. H3 was used for a
nuclear-specific control marker, and COX IV was used for a mitochondria-specific control
marker.
Figure S5. Effect of in vitro transfection with SHP siRNA on FXR agonist-induced
12
mitochondrial apoptotic signaling.
(A) Transfecting NRVMs with SHP siRNA eliminated SHP expression as shown by Western blot
and real-time PCR. NRVMs were transfected with 40 nmol/L of SHP siRNA, AllStars negative
siRNA, or mock-treated for 24 hours. † P<0.01 vs mock-transfected cells. (B-E) Suppression of
SHP by siRNA decreases FXR agonist-induced mitochondrial disruption, including MPTP
opening assessed by calcein-AM/CoCl2 quenching (B, n=4 independent experiments, Bar=20
μm), mitochondrial depolarization by JC-1 staining (C, n=4, Bar=20 μm), mitochondrial
cytochrome c protein by sandwich ELISA (D, n=3), Caspase-9–like and caspase-3–like activities
measured using the colorimetric assay (E, n=4), BCL-2 expression assessed by immunoblots (F,
Upper, n=3), and activated BAX 6A7 by immunofluorescence analysis (F, Bottom, n=3). * P<0.05,
† P<0.01 vs mock-transfected control.
Figure S6. Silencing endogenous FXR in cardiomyocytes by in vitro RNA interference.
NRVMs (A) or H9c2 ventricular cells (B) were transfected with 20 nmol/L of FXR siRNA,
AllStars control siRNA, or mock-treated for 24 hours. Top panel, Confocal images for FXR
expression after siRNA silencing. Bar=10 μm. Bottom panel, FXR mRNA expression quantified
by real-time PCR and shown as percentages of the mock-transfected control, which was defined
as 100%. Data represent the mean±SEM of three independent experiments. * P<0.05, † P<0.01
compared to mock-transfected cells.
Figure S7. Effects of inhibition of MPTP and various caspases upon FXR agonistinduced apoptotic responses in cardiomyocytes.
NRVMs were pretreated with either vehicle (DMSO), cyclosporin A (CsA, 1 μmol/L), ZLEHD-fmk (50 μmol/L), Z-IETD-fmk (50 μmol/L), or Z-ATAD-fmk (50 μmol/L) for 1 hour,
followed by vehicle or GW4064 (5 μmol/L) treatment for 12 (A-E) or 24 hours (F). (A)
Percentage of late apoptotic cells assessed by Hoechst staining. (B) Percentage of early apoptotic
cells, assessed by Annexin V staining. (C) Mitochondrial ΔΨm dissipation, quantified by JC-1
flow cytometry analysis. (D) Cytochrome c protein levels in cytosolic fractions, measured by
sandwich ELISA. (E-F) Caspase-9–like (E) and caspase-3–like (F) activities, measured using the
colorimetric substrate LEHD-AFC or DEVD-AFC, respectively. n=3-4 independent
experiments. * P<0.05, † P<0.01 compared to vehicle-treated cells, ‡ P<0.05, § P<0.01
compared to GW4064-treated cells.
Figure S8. Activation of FXR by oxidative stress in cardiomyocytes.
(A-B) Activation of FXR and its target gene SHP by reoxygenation. Cultured NRVMs were
exposed to hypoxia/reoxygenation (H/R) for the indicated times. Normoxic cells were used as
control. (A) ROS generation assay was quantified with 2’, 7’-Dichlorodihydrofluorescin diacetate
(DCF-DA). Data are normalized with the normoxic control value. (B) FXR and SHP mRNA
was measured by real-time PCR. Results were normalized against GAPDH and converted to
percentage induction relative to normoxic controls. Data are representative of 3-4 independent
experiments. * P<0.05, † P<0.01 compared to normoxic control. (C) ROS inhibitors prevented
FXR activation by reoxygenation. NRVMs were pretreated with either vehicle (DMSO), PBN (10
mmol/L), or NAC (10 mmol/L) for 1 hour before reoxygenation. Normoxic cells were used as
control. Intracellular ROS levels were determined after staining with DCFH-DA (upper,
13
Bar=20μm). FXR and SHP mRNA was measured by real-time PCR (bottom). Results were
normalized against GAPDH and converted to percentage induction relative to normoxic
controls. Data are representative of at least three independent experiments. * P<0.05, † P<0.01
compared to normoxic control; ‡P<0.05, § P<0.01 compared to H/R-treated cells. (D)
Activation of FXR and its target gene SHP by H2O2. Cultured NRVMs were exposed to H2O2
(0-200 μM; n=3 to 4) for 6h. FXR and SHP mRNA was measured by real-time PCR. DMSOtreated cells were used as control. Results were normalized against GAPDH and converted to
percentage induction relative to vehicle controls. * P<0.05, † P<0.01 compared to vehicle control.
(E) FXR was not activated by simulated ischemia-reperfusion in NRVFs. Cells were exposed to 6
hours hypoxia followed by 6 hours reoxygenation. Immunolocalization of FXR in NRVMs and
NRCFs (upper). Images are representative of three independent cultures. Bar=20μm. FXR
mRNA was measured by real-time PCR in NRCFs(bottom). Results were normalized against
GAPDH and converted to fold induction relative to normoxic controls.
Figure S9. Intramyocardial delivery of FXR siRNA effectively eliminated FXR
expression in the left ventricle.
Representative Western blots of FXR (48 hours after transfection, Top panel) and time-courses of
changes in FXR expression after siRNA delivery (Bottom panel). Results are expressed as
percentages of the control siRNA. † P<0.01 vs to control siRNA group (n=4-5 hearts per
group).
14