Sequence Conservation of Pilus Subunits in Neisseria meningitidis
Ana Cehovin1, Megan Winterbotham1, Jay Lucidarme2, Ray Borrow2, Christoph M.
Tang1, Rachel M. Exley*1 and Vladimir Pelicic*1
1
The Centre for Molecular Microbiology and Infection, Flowers Building, Imperial
College London, Armstrong Road, London, SW7 2AZ, UK
2
Vaccine Evaluation Unit, Health Protection Agency North West, PO Box 209,
Clinical Sciences Building 2, Manchester Royal Infirmary, Manchester, M13 9WZ,
UK
*For correspondence:
Tel:
44-20 7594 2080
FAX:
44-20 7594 3095
E-mail:
v.pelicic@imperial.ac.uk; r.exley@imperial.ac.uk
1
Abstract
The rapid onset and dramatic consequences of Neisseria meningitidis infections
make the design of a broadly protective vaccine a priority for public health.
There is an ongoing quest for meningococcal components that are surface
exposed, widely conserved and can induce protective antibodies. Type IV pili
(Tfp) are filamentous structures with a key role in pathogenesis that extend
beyond the surface of the bacteria and have demonstrated vaccine potential.
However, extensive antigenic variation of PilE, the major subunit of Tfp, means
that they are currently considered to be unsuitable vaccine components. Recently
it has been shown that Tfp also contain low abundance pilins ComP, PilV and
PilX in addition to PilE. This prompted us to examine the prevalence and
sequence diversity of these proteins in a panel of N. meningitidis disease isolates.
We found that all minor pilins are highly conserved and, unexpectedly, the
major pilin genes are also highly conserved within the ST-8 and ST-11 clonal
complexes. These data have important implications for the re-consideration of
pilus subunits as vaccine antigens.
Key words: Neisseria, pilin, vaccine
Running Title: Neisserial pilin subunit conservation
2
1. INTRODUCTION
Infections with Neisseria meningitidis account for over 50,000 deaths globally each
year. A large proportion of cases occur in developing countries which experience
large seasonal epidemics [1]. Although endemic in developed countries,
meningococcal disease is still a leading cause of disability and morbidity in
childhood. The non specific early symptoms, rapid onset and traumatic consequences
of meningococcal infections make these an important public health problem and this
has led to the implementation of national vaccination campaigns in several countries
[2].
Meningococci display an antigenically diverse polysaccharide capsule which forms
the basis for grouping into serogroups. Most cases of meningococcal disease are
attributable to serogroups A, B, C, Y and W-135 [3]. The recently developed
multilocus sequence typing (MLST) also groups meningococci according to the allelic
profile of seven housekeeping genes, thus assigning them into sequence type (ST)
clonal complexes [4]. Meningococci from the same ST clonal complex may belong to
different serogroups. In the USA and Europe, the majority of cases of invasive
meningococcal disease are caused by isolates which belong to a limited number of
clonal complexes known as the hyperinvasive lineages (including the ST-1, ST-4, ST5, ST-8, ST-11, ST-32, ST-41/44 and ST-269 clonal complexes) [3]. While anticapsular vaccines are available against serogroups A, C, Y and W135, an effective
vaccine to prevent infection with serogroup B meningococci has yet to be produced
[5].
3
There is an ongoing quest for meningococcal components that are surface exposed,
relatively conserved in sequence, widely prevalent among serogroups/clonal
complexes and which induce antibodies that are either bactericidal or capable of
interfering with pathogenesis or colonization of N. meningitidis. Several promising
candidates have been identified. These include five antigens identified by reverse
vaccinology which, along with an outer membrane vesicle, constitute an
investigational 5 Component Vaccine against Meningococcus B (5CVMB) [6, 7].
Another investigational vaccine comprises two variants of the surface exposed antigen
factor H binding protein (fHBP; previously LP2086 or GNA1870), which is also a
major component of the 5CVMB [8]. However, the search for novel vaccine antigens
is not over since additional meningococcal components may increase coverage and
protection,
whilst
reducing
the
likelihood
of
vaccine
escape
due
to
mutation/recombination.
The contribution of type IV pili (Tfp) to pathogenesis and their surface location made
these organelles attractive candidates in the early 1980s for inclusion in vaccines [9,
10]. Tfp are polymers predominantly of PilE, the major pilin, and are important
virulence factors that contribute to the survival of meningococci in the human host
during both colonization and disease [11]. Notably they have a key role in adhesion to
human cells, either by inducing microcolony formation on cells and/or promoting
twitching motility [12-14]. Furthermore, Tfp promote the rapid emergence of variants
with novel, heritable characteristics by mediating natural competence for DNA
transformation [15]. Tfp in Neisseria have been grouped into two immunotypes,
according to their reaction (class I) or lack of reaction (class II) with the monoclonal
antibody SM1 [16, 17]. Several studies on the closely related pathogen Neisseria
4
gonorrhoeae showed that a vaccine based on pilus preparations is safe and induces
the production of specific antibodies that enhance phagocytosis of bacteria by
peripheral blood leukocytes and inhibit the attachment of gonococci to epithelial cells
[9, 10]. Furthermore, PilE has been shown to be immunogenic during the course of
infection as anti-pilin antibodies can be found in patients infected with N.
gonorrhoeae or N. meningitidis [18, 19]. However, the development of a pilus-based
vaccine has been halted because PilE undergoes extensive antigenic variation in
Neisseria species [20]. Single strains of meningococcus or gonococcus can rapidly
and efficiently evolve to express PilE with different amino acid (aa) sequence [21],
which results from recombination of promoterless pilS cassettes into the pilE gene in
a process known as gene conversion [22-24]. The resulting major pilin subunits have
conserved N-termini but widely variable C-termini. Consequently, anti-Tfp vaccines
provide limited cross protection and field trials were largely unsuccessful [19].
It was recently reported that Tfp in Neisseria species also contain low abundance
proteins that share important sequence and structural features with PilE and are hence
known as minor pilins [25]. In brief, they have a specific prepilin leader peptide that
is cleaved by a dedicated prepilin peptidase and they co-purify with Tfp. As shown
for PilX [26] minor pilins are expected to have 3D structure characteristic of type IV
pilins, including a conserved hydrophobic N-terminal α-helix important for assembly
in the pilus and a variable C-terminal region, which folds into a globular domain.
Within the C-terminal region, two conserved cysteine residues define a hypervariable
domain known as the D-region that is exposed on the surface of the filaments [26,
27]. Minor pilins have important roles in Tfp biology. PilX, PilV and ComP are
dispensable for Tfp biogenesis, but they are essential for pilus-mediated bacterial
5
aggregation, adherence to human cells and competence for natural transformation [2830].
Therefore, in the present study, we investigated the prevalence and sequence variation
of the genes encoding the minor pilins among disease-causing isolates of N.
meningitidis and compared them to that of the gene encoding the major pilin. This has
led to two important findings: 1) we unexpectedly show that although major pilins
have been shown to be extremely variable, the class major class II pilins within the
ST-8 and ST-11 clonal complexes are highly conserved and 2) that the minor pilins,
PilX, PilV and ComP, have highly conserved nucleotide and aa sequences. These data
have important implications for the possible use of the pilus subunits as vaccine
antigens.
2. MATERIALS AND METHODS
2.1 Bacterial isolates and preparation of boilates
N. meningitidis isolates (n=102) were from the Meningococcal Reference Unit
(Manchester, UK). All isolate information including year of isolation, sequence type
(ST), clonal complex, serogroup and site of origin is shown in supplementary data
(Tables S1 and S2). Isolates were grown overnight on blood agar at 37°C, in the
presence of 5% CO2 and suspensions prepared as follows. Several colonies were
resuspended in 250 μL of 0.9% (w/v) saline, heated to 106°C for 20 min and snap
frozen at -20°C for 5 min. The suspensions were then centrifuged at 12000 x g for 5
min and 100 μL of supernatants retained as boilates. Isolates were from individuals
with invasive meningococcal disease in the UK between 1975 and 2001. The samples
6
were from blood (n=73), cerebrospinal fluid (n=8) and nose/throat/other (n=16);
information was not available for five isolates. The isolates were from serogroup B
(n=47), C (n=46), W135 (n=6), Y (n=1) and non groupable (n=2) and from the
following clonal complexes ST11 (n=29), ST269 (n=23), ST41/44 (n=13), ST22
(n=4), ST-32 (n=2), ST-8 (n=29) and one for both ST167 and an unassigned ST (UA).
Also included in the analyses were the sequences of the pilin genes from
meningococcal strains for which whole genome sequences are available: serogroup B
MC58, serogroup A Z2491 and serogroup C FAM18, 053442 and 8013 (Table S3).
2.2 PCR amplification and sequencing of pilin genes
The major pilin gene, pilE, was amplified using primers designed for amplification of
class I or class II alleles either designed in this study or described previously [31].
These primers hybridize to sequences overlapping the stop and start codons (for class
II) or in the regions upstream and downstream (for class I) of the distinct pilE coding
sequences and are based on the sequences of meningococcal strains MC58 and
FAM18 (Figure 1A). The minor pilin genes, pilX, pilV and comP were amplified
using specific primers designed in this study (Figure 1B). All primers are shown in
Table 1. PCR was performed using the following conditions. Reaction mixes
contained either 1.7 U of Expand High Fidelity polymerase (Roche) for amplification
of pilE or Pfu Ultra Fusion polymerase (Agilent Technologies) for amplification of
minor pilin genes. A volume of 2-4 μL of boilates was added to make a total reaction
volume of 25-50 μL. Standard PCR cycling conditions were as follows: 94°C for 2
min, 30 cycles of (94°C for 30 sec, 52°C for 45 sec and 72°C for 3 min), followed by
3 min at 72°C for the amplification of pilE, and 95°C for 5 min, 30 cycles of (95°C
for 30 sec, 50°C for 45 sec and 72°C for 1 min), followed by 10 min at 72°C for the
7
amplification of the minor pilins. The reactions were cooled and stored at 4°C. Where
no pilE gene product was obtained using NG1680 and NG1681, hybridization
temperatures were adjusted to 50°C and the PCR was repeated with primers 5’pilE
and 3’pilE. Following PCR amplification, the DNA fragments were purified using
PCR Clean-up kit (Qiagen). The fragments encoding pilE were cloned into plasmid
pGEMTEasy (Promega). The nucleotide sequence of the forward and reverse strand
of each pilE gene was determined by sequencing with primers M13F and M13R
(Table 1) which hybridize to sequences within the pGEMTeasy vector. Sequencing
reactions were performed by MRC Sequencing Service, Hammersmith Hospital.
Where forward and reverse strands showed sequence discrepancies, sequence
reactions were repeated.
2.3 Sequence alignment and analysis
The nucleotide sequence of each gene was determined for each DNA strand. The
coding sequences of the pilE, pilX, pilV and comP genes were identified by homology
searches using NCBI nucleotide BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and
by manual alignment with either MC58 or FAM18 for pilE sequences or strain 8013
for pilV, pilX and comP sequences using the Serial Cloner 1.3-11 and DNA Strider
1.4 programs. Nucleotide sequences were translated using Serial Cloner 1.3-11 and
DNA Strider 1.4. Protein-coding nucleotide sequences and the deduced aa sequences
were
aligned
using
the
ClustalW2
program
available
at
EBI
(http://www.ebi.ac.uk/Tools/clustalw2/index.html) [32] by Neighbour-joining method
and presented using Boxshade (http://mobyle.pasteur.fr). Phylogenetic analysis of
nucleotide
and
deduced
aa
sequences
was
performed
by
MEGA
4
(http://www.megasoftware.net/) [33] using the Nei-Gojobori and Kimura 2-parameter
8
models [34]. Amino acid identity was determined as percentage of identical residues
common to all sequences. Phylograms were constructed using the ClustalW2 and
visualized with Treeview version 0.5.0. Secondary structure predictions were made
using ESyPred3D Web Server 1.0 [35], with predictions for class I and class II pilins
based on PilE from N. gonorrhoeae and predictions for minor pilins based on N.
meningitidis PilX.
3. RESULTS
3.1 Prevalence, distribution and diversity of gene encoding major pilin (PilE) in N.
meningitidis
The initial strain collection consisted of 56 clinical isolates (Table S1) which were
analysed by PCR for the presence of all the pilin genes: pilE, pilX, pilV and comP.
The pilE gene was successfully amplified from total of 48 of these isolates with
primers specific for either class I or class II alleles (Figure 1A). Results from this
primary analysis demonstrated that the class I pilE allele was present in 31/56 isolates
belonging to five different clonal complexes, while the class II pilE was present in all
isolates belonging to either the ST-11 or ST-8 clonal complexes (17/56). No pilE
product was detectable in a total of eight isolates from ST-32, ST-269 or ST-41/44
clonal complexes using the PCR conditions described in Materials and Methods,
possibly due to sequence variation at the pilE locus rather than absence of the pilE
gene. The amplified pilE genes were sequenced and the nucleotide and deduced aa
sequences of the corresponding mature pilins (excluding the leader peptides) were
aligned. The sequence of class I pilins from sequenced strains of N. meningitidis
MC58 [36], 8013 [37] and Z2491 [38] and class II pilin from meningococcal strain
9
FAM18 [39] were also included for comparison. The extent of variation of class I and
class II pilE genes was calculated as the mean distance between nucleotide sequences
which refers to the number of base differences per nucleotide site from averaging all
sequence pairs using the Kimura’s 2-parameter model, as described in [40].
As expected on the basis of previous observations [41], in the strains harbouring class
I pilins there was considerable variation in pilE, shown by the substantial mean
distance between nucleotide sequences (0.379) (Table 2). Analysis of the mature pilin
sequences revealed that two sequences encoded pilins that were truncated by
premature stop codons (isolates 55 and 66, not shown). The remaining full length
pilins exhibited significant variation, in particular over the hypervariable D-region in
the C-terminus of the protein (Figure 2A). Even strains within the same clonal
complex contained distinct PilE sequences.
In striking contrast, when the class II PilE sequences, found only within the ST-8 and
ST-11 clonal complexes, were aligned they were found to be highly conserved. We
therefore amplified pilE from an additional set of 46 isolates; 41 belonging to these
two clonal complexes and five further isolates from other clonal complexes as
controls (Table S2). We obtained class I pilE sequences from these five isolates and
these are included in Table 1 and Figure 2A. Overall, class II pilE could be amplified
from 29 N. meningitidis isolates from the ST-11 clonal complex and 29 from the ST-8
clonal complex. Pilins within either the ST-8 and ST-11 clonal complexes were
almost identical, as indicated by the very small mean distances between nucleotide
sequences (0.099 and 0.004 respectively) in these strains (Table 2). The majority
(26/29) of ST-8 isolates were found to encode a PilE that was identical apart from a
10
single amino acid change at position 48. The remaining isolates, which are all of the
same sequence type (ST-153) within the ST-8 clonal complex (Table S2), encode a
slightly different PilE in comparison, but which has 99% identity amongst these three
strains (Figure 2B). The mature pilins from the isolates belonging to the ST-11 clonal
complex differed merely by one or two aa at positions 48, 79, 88, 116 and 123 (Figure
2C). The level of conservation of class II pilins was further highlighted by the results
of phylogenetic analysis of all the PilE aa sequences (Figure 3), which identified only
nine aa sequence types among all the clinical isolates expressing class II pilins (n=59)
whereas as many as 37 different aa sequence types were found for the class I pilins
(n=37). Most interestingly, the D-region which is usually ‘hypervariable’ is highly
conserved in the class II pilins (Figure 2).
3.2 Prevalence and diversity of genes encoding minor pilins (PilX, PilV and ComP)
in N. meningitidis
The three genes encoding minor pilins were amplified from 56 clinical isolates
described in Table S1. The pilX, pilV and comP genes were found to be widely
distributed as they were present in 100% of isolates tested. These 168 minor pilin
genes were sequenced and the nucleotide and deduced aa sequences of the
corresponding mature proteins were aligned (Figures 4-6). The corresponding genes
from sequenced strains (Table S3) were also included for comparison. Minor pilins
were all found to be highly conserved with mean distances between nucleotide
sequences ranging from only 0.005 for comP to 0.071 for pilV. A ratio between the
rate of non-synonymous (dN) and synonymous (dS) substitutions per (non)synonymous nucleotide site was used to estimate whether the genes encoding minor
pilins are under selection pressure, as described before [42]. In brief, dN/dS ratios of
11
<1, >1 or 1 suggests that mutations are either under negative or positive selection
pressure or are neutral. The dN/dS ratios calculated for these proteins (Table 3)
suggest that none of the minor pilin genes is under positive selection pressure.
Consequently, the corresponding mature proteins display 73% (PilX), 64% (PilV) and
97% (ComP) aa identity. The most conserved protein, ComP, shows an unexpectedly
limited variation for a surface-exposed protein. Only six aa sequence types were
observed (Table 3), differing only at aa positions 29, 36, 83, 142 and 143 (Figure 4).
For PilX, we identified 23 aa sequence types (Table 3), while for PilV there were 20
aa sequence types (Table 3). In PilX or PilV, the N-terminal extended -helix, which
is necessary for assembly into a pilus fibre [26], was conserved as expected, while
variability was restricted to the C-terminal domain, specifically to the two regions
predicted to be exposed on the surface of the pilus (Figures 5 and 6).
Due to the extremely low variation for ComP, phylogenetic analysis of the aa
sequences was performed only for PilX and PilV. Phylograms revealed that the
deduced aa sequences of these two minor pilins are not randomly distributed but
rather that sequences obtained from the same clonal complexes cluster together. Only
three major protein variants could be identified for both PilX (Figure 5) and PilV
(Figure 6). Variant 1 was present mostly in ST-41/44 and ST-22 clonal complexes,
variant 2 in ST-11 and variant 3 in ST-269, consistent with the very low variability of
minor pilins within clonal complexes.
4. DISCUSSION
12
Subunits of Tfp, one of the most widespread virulence factors in the bacterial world
[11] display many properties which have made them popular candidates for inclusion
in vaccines. Consequently, several studies have so far evaluated their efficacy. For
example, antibodies against the TcpA pilin from Vibrio cholerae inhibit microcolony
formation and attachment of bacteria to epithelial cells in vitro and are protective in
challenge experiments in vivo [43, 44]. Similarly, antibodies directed against N.
gonorrhoeae Tfp were shown to inhibit attachment of gonococci to epithelial cells
and prevent gonococcal infection [9, 10]. In Neisseria the extreme antigenic
variability of PilE provides the bacteria with a mechanism of immune escape and
results in limited cross protection, which has proven the major stumbling block to
development of pilus-based vaccines [19]. Over recent years however, it has become
evident that in addition to the major pilin subunit, minor pilins are also associated
with the Tfp of Neisseria [25, 29]. These proteins influence pilus functions and
dynamics and three of them PilX, PilV and ComP are believed to be components of
the pilus fibre, although only PilX has been shown to co-localize with the assembled
pili [26]. In the present study, as a preliminary evaluation of their potential as vaccine
antigens, we determined sequence conservation of the genes encoding the three minor
pilins PilX, PilV and ComP and sought to compare it to the sequence variability of the
major pilin PilE.
The pilE, pilX, pilV and comP genes were originally amplified from 56 isolates of N.
meningitidis. These were clinical invasive isolates from patients with septicaemia
and/or meningitis collected in the UK from 1975-2001. The majority of isolates
belong to hyperinvasive clonal complexes which are the predominant causes of
invasive meningococcal disease [4]. These include ST-11 isolates which were
13
responsible for the majority of serogroup C meningococcal infections in the UK prior
to the introduction of the serogroup C conjugate vaccination programme [45].
Furthermore the collection includes ST-269 and ST-41/44 clonal complex strains
which are currently responsible for the majority of disease in Europe and North
America [46, 47].
Analysis of the distribution of the class I or class II pilE genes revealed that the class
II pilE allele is present in relevant clinical isolates, consistent with previous reports
that invasive meningococci express pili of both classes [48]. The class I pilE gene was
found in strains belonging to six different clonal complexes, and there was
considerable sequence diversity in the pilE alleles amplified. Of note, eight strains did
not yield a PCR product with primers either for class I or class II pilE. All these
strains belonged to clonal complexes from which class I pilE alleles had been
amplified and the failure to obtain products is consistent with sequence diversity in
the class I pilE locus. In contrast, class II pilE genes were amplified only from isolates
in the related ST-8 and ST-11 clonal complexes [49, 50].
Sequencing of the class I genes confirmed the well known diversity of the major pilin
subunit genes since we identified a different sequence in every isolate. In contrast,
class II pilE genes exhibited a high degree of sequence conservation, which prompted
us to sequence an additional 41 genes from strains belonging to ST-8 or ST-11 clonal
complexes. Only nine different class II pilins were identified from a total of 59
sequences amplified from meningococci that belong to either the ST-8 or ST-11
clonal complex, but which are from various clinical sites, express different capsular
types, are of different sequence types and were isolated from patients in different
14
years. Of particular interest, the small degree of variation in the class II pilin proteins
from either clonal complex corresponds to aa changes which do not localize to the
characterised surface-exposed regions of hypervariability previously described [51].
This absence of variability is remarkable, since it suggests that there is no gene
conversion of pilE in these strains, consistent with previous suggestions [52]. It
remains to be determined why the major pilin subunit in these clonal complexes is so
conserved but these findings suggest that a PilE-based vaccine (a previously
abandoned idea) might be an interesting approach. This is particularly appealing for
ST-11 strains, which are notably associated with higher bacterial loads [53] and
increased morbidity [54-56] and continue to be responsible for outbreaks worldwide
[57, 58] including the epidemics associated with the Hajj pilgrimage [59]. These facts,
together with the recent evidence of possible capsule switching in ST-11 strains [6062] emphasize that it is worth investigating the immunogenicity of these major pilin
subunits and the level of protection they might confer.
Our data indicate that the minor pilins may also represent promising vaccine
candidates. Their prevalence was extremely high: 100% of the isolates tested
harboured all three genes. In addition, the nucleotide and aa sequences of all three
minor pilins were found to be surprisingly conserved (between 64% and 97% identity)
across different serogroups and clonal complexes. The prevalence and conservation of
the minor pilins in N. meninigitidis appear to be comparable to those of the antigens in
the investigational 5CVMB vaccine [6, 7]. As could be predicted, the variability
observed for PilX and PilV (ComP is almost identical in all strains) was restricted to
regions which are proposed to be exposed on the surface of the fibre [26]. However,
the level of variation is very low when compared to the hypervariable class I major
15
pilins. Therefore, since it has been shown that PilX mediates bacterial aggregation
[29], ComP is necessary for natural transformation [28] and PilV impacts on adhesion
[63], this could suggest that sequence conservation of minor pilins may be necessary
for preservation of the Tfp-linked functions they mediate.
The surface exposure of minor pilins and their high conservation across clonal
complexes suggests that these proteins may be potential vaccine candidates for
inclusion in a broadly protective vaccine against N. meningitidis. The observed
clustering of PilV and PilX from strains belonging to the same clonal complex
suggests that a vaccine based on only up to three protein variants of each minor pilin
may cover most hyperinvasive clonal complexes. The most important assessment to
follow is the evaluation of immunogenicity of minor pilins and of their potentially
dual vaccine potential. Indeed, they might protect not only by inducing complementmediated bactericidal activity, which is a generally accepted correlate of protection
[64-66], but also by interfering with Tfp-linked functions, most notably adhesion to
human cells and thereby increasing the protection against N. meningitidis.
ACKNOWLEDGEMENTS
This work was carried out during tenure of a Leverhulme Trust Early Career
Fellowship (RME) and was partly funded by a grant from the Meningitis Research
Foundation (VP).
16
REFERENCES
[1]
Harrison
LH,
Trotter
CL,
Ramsay ME.
Global
epidemiology
of
meningococcal disease. Vaccine 2009;27 Suppl 2:B51-63.
[2]
Campbell H, Borrow R, Salisbury D, Miller E. Meningococcal C conjugate
vaccine: the experience in England and Wales. Vaccine 2009;27 Suppl 2:B20-9.
[3]
Caugant DA, Maiden MC. Meningococcal carriage and disease--population
biology and evolution. Vaccine 2009;27 Suppl 2:B64-70.
[4]
Caugant DA. Genetics and evolution of Neisseria meningitidis: importance for
the epidemiology of meningococcal disease. Infect Genet Evol 2008;8(5):558-65.
[5]
Lewis S, Sadarangani M, Hoe JC, Pollard AJ. Challenges and progress in the
development of a serogroup B meningococcal vaccine. Expert Rev Vaccines
2009;8(6):729-45.
[6]
Giuliani MM, Adu-Bobie J, Comanducci M, Arico B, Savino S, Santini L, et
al. A universal vaccine for serogroup B meningococcus. Proc Natl Acad Sci U S A
2006;103(29):10834-9.
[7]
Jacobsson S, Hedberg ST, Molling P, Unemo M, Comanducci M, Rappuoli R,
et al. Prevalence and sequence variations of the genes encoding the five antigens
included in the novel 5CVMB vaccine covering group B meningococcal disease.
Vaccine 2009;27(10):1579-84.
[8]
Pillai S, Howell A, Alexander K, Bentley BE, Jiang HQ, Ambrose K, et al.
Outer membrane protein (OMP) based vaccine for Neisseria meningitidis serogroup
B. Vaccine 2005;23(17-18):2206-9.
17
[9]
Siegel M, Olsen D, Critchlow C, Buchanan TM. Gonococcal pili: safety and
immunogenicity in humans and antibody function in vitro. J Infect Dis
1982;145(3):300-10.
[10]
Tramont EC, Sadoff JC, Boslego JW, Ciak J, McChesney D, Brinton CC, et
al. Gonococcal pilus vaccine. Studies of antigenicity and inhibition of attachment. J
Clin Invest 1981;68(4):881-8.
[11]
Pelicic V. Type IV pili: e pluribus unum? Mol Microbiol 2008;68(4):827-37.
[12]
Pujol C, Eugene E, de Saint Martin L, Nassif X. Interaction of Neisseria
meningitidis with a polarized monolayer of epithelial cells. Infect Immun
1997;65(11):4836-42.
[13]
Swanson J. Studies on gonococcus infection. IV. Pili: their role in attachment
of gonococci to tissue culture cells. J Exp Med 1973;137(3):571-89.
[14]
Virji M, Kayhty H, Ferguson DJ, Alexandrescu C, Heckels JE, Moxon ER.
The role of pili in the interactions of pathogenic Neisseria with cultured human
endothelial cells. Mol Microbiol 1991;5(8):1831-41.
[15]
Seifert HS, Ajioka RS, Paruchuri D, Heffron F, So M. Shuttle mutagenesis of
Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence. J
Bacteriol 1990;172(1):40-6.
[16]
Virji M, Heckels JE. Antigenic cross-reactivity of Neisseria pili: investigations
with type- and species-specific monoclonal antibodies. J Gen Microbiol
1983;129(9):2761-8.
[17]
Virji M, Heckels JE, Potts WJ, Hart CA, Saunders JR. Identification of
epitopes recognized by monoclonal antibodies SM1 and SM2 which react with all pili
of Neisseria gonorrhoeae but which differentiate between two structural classes of
18
pili expressed by Neisseria meningitidis and the distribution of their encoding
sequences in the genomes of Neisseria spp. J Gen Microbiol 1989;135(12):3239-51.
[18]
Poolman JT, Hopman CT, Zanen HC. Immunogenicity of meningococcal
antigens as detected in patient sera. Infect Immun 1983;40(1):398-406.
[19]
Tramont EC, Boslego JW. Pilus vaccines. Vaccine 1985;3(1):3-10.
[20]
Heckels JE. Structure and function of pili of pathogenic Neisseria species.
Clin Microbiol Rev 1989;2 Suppl:S66-73.
[21]
Seifert HS, Wright CJ, Jerse AE, Cohen MS, Cannon JG. Multiple gonococcal
pilin antigenic variants are produced during experimental human infections. J Clin
Invest 1994;93(6):2744-9.
[22]
Haas R, Meyer TF. The repertoire of silent pilus genes in Neisseria
gonorrhoeae: evidence for gene conversion. Cell 1986;44(1):107-15.
[23]
Hagblom P, Segal E, Billyard E, So M. Intragenic recombination leads to pilus
antigenic variation in Neisseria gonorrhoeae. Nature 1985;315(6015):156-8.
[24]
Swanson J, Bergstrom S, Robbins K, Barrera O, Corwin D, Koomey JM.
Gene conversion involving the pilin structural gene correlates with pilus+ in
equilibrium with pilus- changes in Neisseria gonorrhoeae. Cell 1986;47(2):267-76.
[25]
Koomey M. Prepilin-like molecules in type 4 pilus biogenesis: minor subunits,
chaperones
or
mediators
of
organelle
translocation?
Trends
Microbiol
1995;3(11):409-10; discussion 11-3.
[26]
Helaine S, Dyer DH, Nassif X, Pelicic V, Forest KT. 3D structure/function
analysis of PilX reveals how minor pilins can modulate the virulence properties of
type IV pili. Proc Natl Acad Sci U S A 2007;104(40):15888-93.
19
[27]
Craig L, Volkmann N, Arvai AS, Pique ME, Yeager M, Egelman EH, et al.
Type IV pilus structure by cryo-electron microscopy and crystallography:
implications for pilus assembly and functions. Mol Cell 2006;23(5):651-62.
[28]
Aas FE, Wolfgang M, Frye S, Dunham S, Lovold C, Koomey M. Competence
for natural transformation in Neisseria gonorrhoeae: components of DNA binding
and uptake linked to type IV pilus expression. Mol Microbiol 2002;46(3):749-60.
[29]
Helaine S, Carbonnelle E, Prouvensier L, Beretti JL, Nassif X, Pelicic V. PilX,
a pilus-associated protein essential for bacterial aggregation, is a key to pilusfacilitated attachment of Neisseria meningitidis to human cells. Mol Microbiol
2005;55(1):65-77.
[30]
Wolfgang M, van Putten JP, Hayes SF, Koomey M. The comP locus of
Neisseria gonorrhoeae encodes a type IV prepilin that is dispensable for pilus
biogenesis but essential for natural transformation. Mol Microbiol 1999;31(5):134557.
[31]
Kahler CM, Martin LE, Tzeng YL, Miller YK, Sharkey K, Stephens DS, et al.
Polymorphisms in pilin glycosylation Locus of Neisseria meningitidis expressing
class II pili. Infect Immun 2001;69(6):3597-604.
[32]
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,
McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics
2007;23(21):2947-8.
[33]
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007;24(8):1596-9.
[34]
Page RD, Holmes EC. Molecular Evolution: A Phylogenetic Approach. 1 ed:
Blackwell Science, 1998.
20
[35]
Lambert C, Leonard N, De Bolle X, Depiereux E. ESyPred3D: Prediction of
proteins 3D structures. Bioinformatics 2002;18(9):1250-6.
[36]
Tettelin H, Saunders NJ, Heidelberg J, Jeffries AC, Nelson KE, Eisen JA, et
al. Complete genome sequence of Neisseria meningitidis serogroup B strain MC58.
Science 2000;287(5459):1809-15.
[37]
Rusniok C, Vallenet D, Floquet S, Ewles H, Mouze-Soulama C, Brown D, et
al. NeMeSys: a biological resource for narrowing the gap between sequence and
function
in
the
human
pathogen
Neisseria
meningitidis.
Genome
Biol
2009;10(10):R110.
[38]
Parkhill J, Achtman M, James KD, Bentley SD, Churcher C, Klee SR, et al.
Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491.
Nature 2000;404(6777):502-6.
[39]
Bentley SD, Vernikos GS, Snyder LA, Churcher C, Arrowsmith C,
Chillingworth T, et al. Meningococcal genetic variation mechanisms viewed through
comparative analysis of serogroup C strain FAM18. PLoS Genet 2007;3(2):e23.
[40]
Jacobsson S, Thulin S, Molling P, Unemo M, Comanducci M, Rappuoli R, et
al. Sequence constancies and variations in genes encoding three new meningococcal
vaccine candidate antigens. Vaccine 2006;24(12):2161-8.
[41]
Hill SA, Davies JK. Pilin gene variation in Neisseria gonorrhoeae: reassessing
the old paradigms. FEMS Microbiol Rev 2009;33(3):521-30.
[42]
Bambini S, Muzzi A, Olcen P, Rappuoli R, Pizza M, Comanducci M.
Distribution and genetic variability of three vaccine components in a panel of strains
representative
of
the
diversity
of
serogroup
B
meningococcus.
Vaccine
2009;27(21):2794-803.
21
[43]
Kirn TJ, Lafferty MJ, Sandoe CM, Taylor RK. Delineation of pilin domains
required for bacterial association into microcolonies and intestinal colonization by
Vibrio cholerae. Mol Microbiol 2000;35(4):896-910.
[44]
Sun DX, Mekalanos JJ, Taylor RK. Antibodies directed against the toxin-
coregulated pilus isolated from Vibrio cholerae provide protection in the infant mouse
experimental cholera model. J Infect Dis 1990;161(6):1231-6.
[45]
Russell JE, Urwin R, Gray SJ, Fox AJ, Feavers IM, Maiden MC. Molecular
epidemiology of meningococcal disease in England and Wales 1975-1995, before the
introduction of serogroup C conjugate vaccines. Microbiology 2008;154(Pt 4):11707.
[46]
Law DK, Lorange M, Ringuette L, Dion R, Giguere M, Henderson AM, et al.
Invasive meningococcal disease in Quebec, Canada, due to an emerging clone of ST269 serogroup B meningococci with serotype antigen 17 and serosubtype antigen
P1.19 (B:17:P1.19). J Clin Microbiol 2006;44(8):2743-9.
[47]
Lucidarme J, Comanducci M, Findlow J, Gray SJ, Kaczmarski EB, Guiver M,
et al. Characterization of fHbp, nhba (gna2132), nadA, porA, sequence type (ST), and
genomic presence of IS1301 in group B meningococcal ST269 clonal complex
isolates from England and Wales. J Clin Microbiol 2009;47(11):3577-85.
[48]
Aho EL, Keating AM, McGillivray SM. A comparative analysis of pilin genes
from pathogenic and nonpathogenic Neisseria species. Microb Pathog 2000;28(2):818.
[49]
Claus H, Friedrich A, Frosch M, Vogel U. Differential distribution of novel
restriction-modification systems in clonal lineages of Neisseria meningitidis. J
Bacteriol 2000;182(5):1296-303.
22
[50]
Claus H, Weinand H, Frosch M, Vogel U. Identification of the hypervirulent
lineages of Neisseria meningitidis, the ST-8 and ST-11 complexes, by using
monoclonal antibodies specific to NmeDI. J Clin Microbiol 2003;41(8):3873-6.
[51]
Parge HE, Forest KT, Hickey MJ, Christensen DA, Getzoff ED, Tainer JA.
Structure of the fibre-forming protein pilin at 2.6 A resolution. Nature
1995;378(6552):32-8.
[52]
Aho EL, Botten JW, Hall RJ, Larson MK, Ness JK. Characterization of a class
II pilin expression locus from Neisseria meningitidis: evidence for increased diversity
among pilin genes in pathogenic Neisseria species. Infect Immun 1997;65(7):261320.
[53]
Darton T, Guiver M, Naylor S, Jack DL, Kaczmarski EB, Borrow R, et al.
Severity of meningococcal disease associated with genomic bacterial load. Clin Infect
Dis 2009;48(5):587-94.
[54]
Trotter CL, Chandra M, Cano R, Larrauri A, Ramsay ME, Brehony C, et al. A
surveillance network for meningococcal disease in Europe. FEMS Microbiol Rev
2007;31(1):27-36.
[55]
Trotter CL, Fox AJ, Ramsay ME, Sadler F, Gray SJ, Mallard R, et al. Fatal
outcome from meningococcal disease--an association with meningococcal phenotype
but not with reduced susceptibility to benzylpenicillin. J Med Microbiol
2002;51(10):855-60.
[56]
Zarantonelli ML, Lancellotti M, Deghmane AE, Giorgini D, Hong E, Ruckly
C, et al. Hyperinvasive genotypes of Neisseria meningitidis in France. Clin Microbiol
Infect 2008;14(5):467-72.
23
[57]
Fazio C, Neri A, Tonino S, Carannante A, Caporali MG, Salmaso S, et al.
Characterisation of Neisseria meningitidis C strains causing two clusters in the north
of Italy in 2007 and 2008. Euro Surveill 2009;14(16).
[58]
von Gottberg A, du Plessis M, Cohen C, Prentice E, Schrag S, de Gouveia L,
et al. Emergence of endemic serogroup W135 meningococcal disease associated with
a high mortality rate in South Africa. Clin Infect Dis 2008;46(3):377-86.
[59]
Kelly D, Pollard AJ. W135 in Africa: origins, problems and perspectives.
Travel Med Infect Dis 2003;1(1):19-28.
[60]
Lancellotti M, Guiyoule A, Ruckly C, Hong E, Alonso JM, Taha MK.
Conserved virulence of C to B capsule switched Neisseria meningitidis clinical
isolates belonging to ET-37/ST-11 clonal complex. Microbes Infect 2006;8(1):191-6.
[61]
Beddek AJ, Li MS, Kroll JS, Jordan TW, Martin DR. Evidence for capsule
switching between carried and disease-causing Neisseria meningitidis strains. Infect
Immun 2009;77(7):2989-94.
[62]
Castilla J, Vazquez JA, Salcedo C, Garcia Cenoz M, Garcia Irure JJ, Torroba
L, et al. B:2a:p1.5 meningococcal strains likely arisen from capsular switching event
still spreading in Spain. J Clin Microbiol 2009;47(2):463-5.
[63]
Winther-Larsen HC, Hegge FT, Wolfgang M, Hayes SF, van Putten JP,
Koomey M. Neisseria gonorrhoeae PilV, a type IV pilus-associated protein essential
to human epithelial cell adherence. Proc Natl Acad Sci U S A 2001;98(26):15276-81.
[64]
Balmer P, Borrow R. Serologic correlates of protection for evaluating the
response to meningococcal vaccines. Expert Rev Vaccines 2004;3(1):77-87.
[65]
Frasch CE, Borrow R, Donnelly J. Bactericidal antibody is the immunologic
surrogate of protection against meningococcal disease. Vaccine 2009;27 Suppl
2:B112-6.
24
[66]
Vermont C, van den Dobbelsteen G. Neisseria meningitidis serogroup B:
laboratory correlates of protection. FEMS Immunol Med Microbiol 2002;34(2):89-96.
[67]
Wainwright LA, Pritchard KH, Seifert HS. A conserved DNA sequence is
required for efficient gonococcal pilin antigenic variation. Mol Microbiol
1994;13(1):75-87.
[68]
Cahoon LA, Seifert HS. An alternative DNA structure is necessary for pilin
antigenic variation in Neisseria gonorrhoeae. Science 2009;325(5941):764-7.
25
Table 1. Oligonucleotide primers used in this study.
Gene
pilE (class I)
pilE (class II)
pilX
Primer
Sequence (5' to 3')
Reference
NG1680 CCTTGCAAACCTTTAAAAAGG
This study
NG1681 TAATACACAGGTATCGCAACA
This study
5’ pilE
CCGATGGTCAAATACATTGC
This study
3’ pilE
GCGCCTGTCAGATAAACCACG
This study
NG1705 GTCAAACCCGGTCATTGTCC
[31]
NG1706 CAGGAGTCATCCAAATGAAAGC
[31]
pilX-F
TTATCGGGTTACTGCCAAGG
This study
pilX-F2
GTCGTCCTTCAATCTTATGT
This study
pilX-R
CCTGTCGGTTTCGGTTTTT
This study
pilX-R2
TGTTAATCCACTATACCCATAAA
This study
pilV-F
TGCTTTCCCGAAAATTTCAA
This study
pilV-F2
GTTTACATATTCCGCCATTT
This study
pilV-R
TAAGCATACGCTTCCGCATC
This study
pilV-R2
TCCGATATAAGGGTAAGCAT
This study
comP-F
TGTTGAATAATCTGTTCTTATTGGAAG
This study
comP-R
CGGAAAACCGCACAAATACT
This study
cloned in
M13F
GTAAAACGACGGCCAG
Invitrogen
pGEMTeasy
M13R
CAGGAAACAGCTATGAC
Invitrogen
pilV
comP
26
Table 2. Class I and class II pilE genes. Length, number of isolates from which genes
were sequenced, corresponding number of alleles identified and overall mean distance
between nucleotide sequences.
Length
No. of
No. of
Mean distance between
(bp)
isolates
alleles
nucleotide sequencesa
Class I
177-522
39b
39
0.379
Class II (total)
444-459
59c
12
0.204
Class II (ST-8)
444-459
29
4
0.099
Class II (ST-11)
447
30
8
0.004
pilE
a
The number of base differences per nucleotide site from averaging all sequence pairs
using the Kimura’s 2-parameter model.
b
39 isolates corresponds to 31 isolates described in Table S1, 5 isolates described in
Table S2 and 3 sequenced strains of N. meningitidis
c
59 isolates corresponds to 17 isolates described in Table S1, 41 isolates described in
Table S2 and 1 sequenced strain of N. meningitidis
27
Table 3. Minor pilin genes in 56 meningococcal isolates and five sequenced genomes.
Length and number of alleles, length and number of deduced aa sequence types of
mature pilins. The overall mean distances, numbers of synonymous and
nonsynonymous substitutions and dN/dS ratios are also indicated for each gene.
Mean
No. of sites
distance
No. of aa
No. of
Gene
Length (bp)
dN/dS
between
alleles
Non-
nucleotide
Length (aa)
sequence
ratioa
Synonymous
synonymous
types
sequences
pilX
489-513
26
0.033
107
375
0.683
152-160
23
pilV
387-390
23
0.071
94
291
0.53
121-122
20
comP
450
6
0.005
96
350
0.06
143
6
adN/dS:
A measure for estimating whether a particular sequence is under selection
pressure. dN/dS < 1: non-synonymous mutations are under negative selection; dN/dS
= 1: all changes are neutral; dN/dS > 1: substitutions are driven by positive selection.
28
FIGURE LEGENDS
Figure. 1. Schematic representation of the genomic loci encoding major and minor
pilins. (A) Representative loci encoding class I and class II pilE genes in MC58 and
FAM18 genomes, respectively. The positions of primers used to amplify the pilE
genes are shown (arrows). Sma/Cla [67] and G4 sequences [68] implicated in pilin
antigenic variation through gene conversion are shown as black and grey bars
respectively. lpxC: UDP-3-0-(s-hydroxymyristoyl) N-acetylglucosamine deacetylase;
fbp: putative FKBP-type peptidyl-prolyl cis-trans isomerase; kat: catalase. (B)
Representative loci encoding pilX, pilV and comP in MC58. Genetic environment
surrounding the genes is similar in other sequenced genomes of N. meningitidis. The
positions of primers used to amplify each minor pilin gene are shown (arrows). All
the genes are drawn to scale. dut; deoxyuridine 5’- triphosphte nucleotidohydrolase;
adh; alcohol dehydrogenase; mfp; membrane fusion protein.
Figure 2. Alignment of major pilin PilE sequences. Isolate identification number or
name and clonal complex (ST) are shown for each sequence. Conserved residues are
black, non-identical residues are white on black background, similar residues are grey
and gaps are indicated with hyphens. (A) Class I pilins. The mature full length pilin
sequences deduced from 34 N. meningitidis isolates and three sequenced strains
MC58, Z2491 and 8013, were aligned using ClustalW and presented using Boxshade.
(B) and (C) Class II pilins. The predicted mature pilin sequences deduced from the 29
clonal complex ST-8 N. meningitidis isolates (B) and from the 29 clonal complex ST11 N. meningitidis isolates and sequenced strain FAM18 (C) were aligned using the
described methods. A schematic representation of the predicted secondary structure
29
based on the structure of gonococcal pilin [51] is shown. Wavy lines represent αhelices and arrows represent ß-sheets. The D-region defined by two cysteine residues
is indicated. The D-region which is hypervariable in class I pilins is highly conserved
in the class II pilins.
Figure 3. Phylogram of mature peptide sequence of class I and class II pilins from all
meningococcal isolates used in this study as well as previously sequenced N.
meningitidis strains (Table S1-S3). Isolate identification number or name and clonal
complex (ST) are shown for each sequence.
Figure 4. Alignment of ComP minor pilins. To improve the readability of this figure,
shown are only the different aa sequence types that were identified in the 56
meningococcal isolates and in the five sequenced meningococcal genomes.
Representative isolate number or name of sequenced strain is shown together with ST.
White, grey or black shading indicates identical, similar or different residue from
consensus, respectively. The predicted secondary structure is indicated at the bottom
of the alignment with waves and arrows corresponding to α-helices and β-sheets,
respectively.
Figure 5. The PilX minor pilin. (A) Alignment of PilX minor pilins. Only the
different aa sequence types that were identified in 56 isolates and in the 5 sequenced
meningococcal genomes are shown. Representative isolate number or name of
sequenced strain is shown together with ST. White, grey or black shading indicates
identical, similar or different residue, respectively. The secondary structure is
indicated at the bottom of the alignment with waves and arrows corresponding to α-
30
helices and β-sheets, respectively. (B) Neighbour-joining phylogenetic tree of PilX.
Three major variants of PilX (indicated) were identified.
Figure 6. The PilV minor pilin. (A) Alignment of PilV minor pilins. Only the
different aa sequence types that were identified in 56 isolates and in the 5 sequenced
meningococcal genomes are shown. Representative isolate number or name of
sequenced strain is shown together with ST. White, grey or black shading indicates
identical, similar or different residue, respectively. The predicted secondary structure
is indicated at the bottom of the alignment with waves and arrows corresponding to αhelices and β-sheets, respectively. (B) Neighbour-joining phylogenetic tree of PilV.
Three major variants of PilV (indicated) were identified.
31