Supplementary Materials and Methods
Construction of recombinant adenoviruses encoding murine IFNγ
Briefly, the mIFNγ cDNA was subcloned into the multicloning site of AdTrack-CMV
shuttle vector that contains green fluorescent protein as reporter gene. The subclonation
of mIFNγ cDNA was in position between the cytomegalovirus promoter and
polyadenylation site, specifically in the XhoI and HindIII restriction sites. The resultant
plasmid was linearized by digestion with PmeI endonuclease restriction enzyme and
cotransformed into E.coli BJ5183 strain cells with the AdEasy-1 adenoviral plasmid,
which contains all sequences of adenovirus serotype Ad5 except nucleotides
encompassing the E1 and E3 genes. Recombinant bacteria were selected by kanamycin
resistance, and recombination was confirmed by PacI endonuclease restriction analysis.
Finally the linearized recombinant plasmid was transiently transfected into the
packaging 293-cells (ATCC # CRL-1573) that supply the E1 proteins necessary to
generate adenovirus, using LipofectAMINE (Invitrogen) following manufacturer's
recommendations. Green fluorescent protein recombinant adenovirus (AdGFP) was
constructed similarly; the procedure was facilitated because the GFP gene was
integrated into the pAdTrack-CMV. Recombinant adenoviruses were selected three
times from 293-infected cells and tested each time by Western blot, as described below
to confirm mIFNγ expression.
Production of high titers of AdIFNγ and AdGFP
Fibra-cel
disks
are
electrostatical
(http://www.nbsc.com/products/spinner.htm),
composed
support
of
matrices
polyester
and
polypropylene, conforming a three-dimensional network that permits efficient
adenovirus-infected cells attachment and active cell growth. Approximately 150x106
293-cells were inoculated into a spinner basket loaded with 5 g of fibra-cel disks,
Dulbecco’s Modified Eagle’s Medium (DMEM) with 4.5g/L glucose and 10% fetal
bovine serum (FBS) (Gibco/BRL, Gran Island, NY, USA.). The spinner basket was
incubated at 37°C under continuous stirring during 7 days. The pH of the culture
medium was neutral and was constantly monitored during the incubation time. To
generate higher titer viral stocks, these 293-cells in spinner baskets were infected with
AdIFNγ or AdGFP at a multiplicity of infection (MOI) of 0.1 for 5 days, which in
preliminary kinetic studies showed to be the time and MOI for maximal viral
production. The efficiency of this infection was easily followed with the detection of
GFP by fluorescence microscopy. After 5 days, the supernatant cultures were collected
and immediately processed to purify adenoviruses by precipitation using polyethylene
glycol at 10% (Sigma) and 0.5 M NaCl (Sigma), followed by exhaustive dialysis against
the storage buffer containing 1 M Tris, pH 8.0, 1 M MgCl2, and 5% sucrose. This
procedure usually yielded between 1- 3 x 1011 recombinant purified adenoviruses from
500 ml of supernatant.
Stocks of purified adenovirus were titrated by counting plaques-forming units (PFU).
Briefly, 293-cell monolayers were infected with serial dilutions of the virus stock,
incubated for 40h at 37°C and fixed with methanol:acetone (1:1), and washed twice
with phosphate buffered saline (PBS). Viral plaques detection was performed with
polyclonal rabbit anti-adenovirus antibodies diluted 1/1000, and incubated overnight at
4°C. After washing, cells were incubated with protein A labeled with peroxidase,
diluted 1/1000 (Sigma) during one hour at room temperature. Peroxidase was revealed
with 3,3’dimetoxibenzidine (Sigma) and H2O2. Viral plaques (PFU) were counted using
an invert microscope.
Determination of IFNγ secretion and bioactivity in the supernatants of Mv1Lu cells
infected with recombinant adenovirus
Mv1Lu lung epithelial cells (ATCC # CCL-64) from the American Type Culture
Collection (Rockville, MD) suspended in DMEM containing 10% FBS were seeded in
6-well multicluster wells (7 x 105 per well). On the following day, Mv1Lu cells were
infected with (MOI=250) AdIFNγ or AdGFP for 1h in medium without FBS. After 72h
of incubation, we checked the efficiency of infection through detection of GFP by
fluorescence microscopy. Then, supernatants were recovered and stored at -70°C until
use.
Supernatants were used to quantify levels of secreted IFNγ using ELISA kit
(Pharmigen, San Jose CA, USA). Briefly, 96-well plates were precoated with 0.5 μg/ml
of monoclonal anti-mouse IFNγ dissolved in 100 μl of 0.05 M carbonate buffer, pH 9.5,
incubated overnight at 4°C. After washing with PBS-Tween 20 at 0.05%, wells were
blocked with 3% bovine serum albumin (BSA) (Sigma) in PBS for 2h at 37°C. Diluted
supernatants and the standard curve of recombinant IFNγ were incubated per duplicate
for 2h at 37°C. After washing, biotinylated polyclonal rabbit anti-mouse IFNγ diluted
1/250 in PBS-3% BSA were incubated with streptavidin peroxidase diluted 1/250 in
PBS-3% BSA for 1 h at room temperature. To reveal, tetramethylbenzidine and H2O2
(Pharmigen, San Diego CA.US) were used, and the optical density measured at 450 nm.
For Western blotting, equal amounts of protein from supernatants were electrophoresed
in polyacrylamide gels (8%) and transferred to polyvinylidene difluoride membranes
(Millipore). Membranes were probed using 1/500 of the anti-mouse IFNγ antibody
(R&D systems) and 1/10000 of the peroxidase anti-IgG goat (R&D systems).
Immunoblots were revealed using the enhanced chemiluminescence kit (Amersham
Biosciences, New Jersey, USA ).
To verify the biological activity of the secreted IFNγ, we determined nitrite production
by mouse macrophages stimulated during 18h with supernatants from Mv1Lu cells
infected with either AdIFNγ or AdGFP. To obtain peritoneal macrophages, Balb/c mice
were intraperitoneally injected with 1 ml of sterile light mineral oil (Sigma), and after 5
days peritoneal macrophages were collected from 10 animals in sterile conditions.
Collected cells were washed twice with Alsever solution (0.1M glucose, 27 mM sodium
citrate, 2 mM citric acid, 71 mM sodium chloride, pH 6.1) to remove oil excess.
Then, cells were centrifuged and red cells were eliminated with lysis buffer (0.2%
sodium chloride, stirring and adding 1.6% sodium chloride). After washing with
Alsever solution, recovered macrophages were resuspended in DMEM medium with
10% FBS, and seeded in 96-well multicluster wells (1 x 106 per well). After three hours,
the cultured medium was substituted by different dilutions of supernatants from Mv1Lu
cells infected with AdIFNγ or AdGFP, and incubated at 37°C with 5% CO2 for 18h. To
determine nitrites production, 50 μl of supernatant from each well was transferred to
another plate and incubated with 150 μl of 1:1 solution of 0.1% sulfanilamide dissolved
in water, and 0.1% N-(1-naphthyl) ethylenediamine dihydrochloride in 2.5% phosphoric
acid (Griess reactant). After 10 min, nitrite concentration was determined by
spectrophotometry at 540 nm on a microtiter plate reader using a standard curve
solution with known concentrations of sodium nitrite.
Experimental model of progressive pulmonary tuberculosis.
Male Balb/c mice 6-8 weeks age were anesthetized with sevofluorane and infected
using a rigid stainless steel cannula as described above, administering 2.5 x 105 viable
bacteria suspended in 100 μl of PBS. Infected mice were maintained in groups of five in
cages fitted with microisolators connected to negative pressure. All procedures were
performed in a biological security cabinet, P3. The protocol was approved by the Ethics
Committee for Experimentation in Animals of the National Institute of Medical
Sciences and Nutrition in México.
Immunohistochemistry.
The same paraffin embedded tissue used for histology was used for this method. Lung
sections were mounted in silane covered slides, deparaffinized, and the endogenous
activity of peroxidase was quenched with 0.03% H2O2 in absolute methanol. Lung
sections were incubated over night at room temperature with rabbit polyclonal specific
antibodies against murine IFNγ
(Santa Cruz, Biotechnology, USA)
or rabbit
polyclonal specific antibodies against adenovirus antigens. After incubation with goat
anti-rabbit antibodies labeled with biotin, bound antibodies were detected with the
system avidin-biotin peroxidase, and revealed according to manufacturer’s instructions
(Vectastain, Vector laboratories , CA, USA).
Primers to real time PCR analysis
Specific primers were designed using the program Primer Express (Applied Biosystems,
USA) for the following targets: glyceraldehyde-3-phosphate dehydrogenase (G3PDH):
5´-ggcgctcaccaaaacatca-3´, 5´-ccggaatgccattcctgtta -3´, iNOS: 5´-agcgaggagcaggtggaag3´, 5´-catttcgctgtctccccaa-3´, TNFα: 5´-tgtggcttcgacctctacctc-3´, 5´-gccgagaaaggctgcttg3´, IFNγ: 5´-ggtgacatgaaaatcctgcag-3´, 5´-cctcaaacttggcaatactcatga-3´, CCL2 5’ctctcttcctccaccaccatg-3’,
5’-ttaactgcatctgcctgagcc-3’
ccagccaggtgtcattttcc’, 5’ttggagtcagcgcagatgtg-3’.
and
CCL3
5’
–