Genetic Structure of Endangered Northeastern Bulrush (Scirpus ancistrochaetus) in Pennsylvania, USA using information from RAPDs and SNPs Kendra Cipollini • Kendra Millam • Douglas Burks • Don Cipollini • Sarah Girod • Zachary VanGundy • Jeffrey Peters Kendra Cipollini () • Douglas Burks • Sarah Girod • Kendra Millam • Zachary VanGundy Wilmington College 1870 Quaker Way Wilmington, OH USA 45177 e-mail: KAL143@alumni.psu.edu, FAX : 937-383-8530, Phone : 937-382-6661 x367 Don Cipollini • Kendra Millam • Jeffrey Peters Wright State University 3640 Colonel Glenn Hwy Dayton, OH USA 45435 1 Abstract Northeastern bulrush, Scirpus ancistrochaetus, is a federally endangered wetland plant species found primarily in Pennsylvania, USA. Data on the population genetic structure of this species is needed by conservation managers to prioritize conservation efforts. In this study, we used two genetic marker systems to examine diversity and structure of this species in populations throughout Pennsylvania. The first simple and inexpensive approach utilized RAPD primers, while our second more detailed approach relied on DNA sequencing of single nucleotide polymorphisms (SNPs). We found genetic variation using both RAPDs and sequencing and found some overlap in information between the two methods, including clusters of related populations and the identification of a genetically unique population. Future studies will seek to examine variation across the full geographic range of the species. Keywords conservation • Cyperaceae • plant • population structure Introduction Northeastern bulrush, Scirpus ancistrochaetus Schuyler (Cyperaceae), is a sedge that is currently classified as endangered in the United States (Schuyler 1962, USFWS 1991). This species is found in eight states in the northeastern United States, with over half of the known populations located in the state of Pennsylvania (USFWS 1991). Nearly all of the existing research on this species involves studies of ecological factors that may limit its distribution, such as water levels (Lentz and Dunson 1998), light availability and herbivory (Lentz and Cipollini 1998; Cipollini and Cipollini 2011) and water chemistry (Lentz and Dunson 1999; Lentz-Cipollini and Dunson 2006). Its habitat in Pennsylvania consists of fairly small, usually ephemeral, wetlands isolated 2 from each other in a forested landscape (Cipollini and Cipollini 2011). The species can be found either in a single isolated wetland or in a small percentage of wetlands within a complex of wetlands clustered together, yet still generally isolated from other such complexes. Very little is known about gene flow and seed dispersal in S. ancistrochaetus and whether populations are genetically isolated from one another. Because the seeds have barbed bristles (e.g., Carter 1993) and easily attach to clothing (K. Cipollini, personal observation), it is hypothesized that seeds are dispersed by animals (Cipollini and Cipollini 2011). However, there appears to be little recruitment into the population through seedlings (K. Cipollini, personal observation). The primary mode of reproduction once a population establishes is most likely clonal, both through the expansion of an individual clump by shoots forming from the roots and by shoots forming in the nodes and heads of the flowering culms, which subsequently fall into the water and form roots (Bartgis 1992). This reproductive strategy, whereby one or a few individuals found a population, followed by extensive clonal growth, is termed the “Initial Seedling Recruitment (ISR)” strategy (Eriksson 1989). Some plant species rely heavily on clonal reproduction (Jusaitis and Adams 2005), and this strategy could result in strong differentiation even among populations within close proximity to each other (McLellan et al. 1997). Like animal dispersal of seeds, wind pollination may also facilitate gene flow among populations and thereby inhibit genetic differentiation (Loveless and Hamrick 1984); populations of S. ancistrochaetus are often widely separated in the field and it would appear unlikely that many exchange genetic material through wind pollination over long distances. The extent to which populations of S. ancistrochaetus vary genetically at either a local or regional scale is unknown. Because this species appears to reproduce primarily asexually, some of the populations may consist of one or a few clones and exhibit low within-population 3 variation (Vandepitte et al. 2010). However, genetic diversity of some clonal species can be high (Esselman et al. 2009; Goertzen et al. 2011). Additionally, the population size within a wetland can fluctuate from year to year, which can decrease genetic variation due to the effects of genetic drift (Loveless and Hamrick 1984). Genetic diversity is critical for endangered populations to maintain the capacity to respond to environmental change (Barrett and Kohn 1991). Unfortunately, the long-term viability of wild populations is frequently assessed by monitoring adult census sizes only. In fact, a recent recommendation to change the legal status of S. ancistrochaetus from “endangered” to “threatened” was based primarily on census information (USFWS 2009; Cipollini and Cipollini 2011). However, the genetic effective population size is of primary importance for long-term viability, and monitoring of adult census size can give misleading impressions of this variable (Brede and Beebee 2006). Examining genetic diversity within and among populations can provide information that can be used to examine effective population sizes. Such data will also allow identification of ecologically significant units to target for enhanced protection and management of a species of concern (Pillon et al. 2007). Measures of population genetic structure and history can be obtained using co-dominant DNA markers such as RAPDs (Randomly Amplified Polymorphic DNA) or DNA sequences including SNPs (Single Nucleotide Polymorphisms). RAPDs are a relatively low cost method that can quickly produce a large number of dominant markers, even when there is no DNA information available on the species of interest (Williams et al. 1990), and have been used in the study of diversity in endangered clonal plants (McGlaughlin and Friar 2007). However, RAPDs can have a low level of reproducibility (Jones et al. 1997) and are best used in conjunction with other markers. With advances in sequencing technology, single nucleotide polymorphisms (SNPs) have been increasingly used as a method for elucidating population history (Brumfield et 4 al. 2003). SNPs are particularly useful in the case of species with limited genetic diversity (e.g., Foster et al. 2010), and have been used to study population structure in fungal species of conservation interest (Amend et al. 2010). Segments of DNA containing SNPs can be identified in species for which little or no sequence information is available by using the sequences of microsatellites previously developed for closely related species (Primmer et al. 2002). In this study, we used two approaches – RAPDs and SNPs - to examine genetic diversity and structure in S. ancistrochaetus from 17 populations sampled throughout Pennsylvania. Materials and Methods Sampling and DNA Extraction Seventeen sites were chosen based on their distribution in Pennsylvania, with an attempt to sample fairly evenly across the range (Fig. 1). Distances between sites ranged from ~4 km to ~250 km. Population sizes of the sampled populations ranged from only 50 stems to over 100,000 estimated stems. When multiple samples were collected per site, we took care to avoid collection from the same clump, though we cannot rule out the possibility that samples may be part of the same clone. Leaf samples were placed in bags with anhydrous silica gel desiccant (Fisher Scientific, Pittsburgh, PA, USA) until returned to the laboratory, where they were stored at -4°C. Approximately 2 mg of leaf material was homogenized in liquid nitrogen using a tissue homogenizer or approximately 10 mg of leaf material was ground using a mortar and pestle in liquid nitrogen. DNA was then isolated using DNeasy Plant Mini Kits (Qiagen Sciences, Germantown, MD, USA), following manufacturer instructions. 5 RAPDs RAPD analyses were performed in laboratories at Wilmington College. PCR amplification of RAPD bands was performed using RAPD 10mer primers (Operon Technologies, Inc., Alameda, CA, USA). Approximately 20 ng of genomic DNA was mixed with 200 nmol of primer in a buffer containing 1X reaction buffer, 6 mM MgCl2, 100uM of each dNTP, and 2.5 units of Taq DNA polymerase (Qiagen Sciences, Germantown, MD, USA), with a final volume of 50μL. Amplification was done with a denaturing temperature of 94°C for 30 seconds for renaturation, 34°C to 39°C, depending on primer, for 30 seconds, and 74°C for the polymerization reaction for 90 seconds. This cycle was repeated 39 times. A final polishing cycle was done at 74°C for 2,400 seconds. Amplified DNA was separated on 1.7% agarose gels (MBL International Corporation, Woburn, MA, USA) at 150 V for four hours at 7°C and stained with ethidium bromide (EtBr). Bands were scored by visual methods from enlarged photographs. We screened ten RAPD primers for variation. Three RAPD primers (OPC-06 [5′GAACGGACTC-3’], OPC-19 [5′-GGTGCACGTT-3′], OPC-20[5′-ACTTCGCCAC-3′) produced diverse banding patterns across sites. To examine variation within a site, we used one RAPD primer (which showed variation between sites) for 10 individuals collected from one wetland and failed to find variation in RAPD banding patterns. Because we did not find variation for our RAPD marker within our populations, we arbitrarily selected one individual from each site for our final population structure analyses to focus on variation between populations. We constructed equally weighted maximum parsimony trees for the RAPD data using PAUP* 4.0b10 (Swofford 1999). We used a Mantel test in the program ZT (Bonnet & Van de Peer 2002) to test for an association between geographic and genetic distance. This test 6 accounts for the non-independence of correlating distance matrices. Genetic distances (uncorrected p-distance) were calculated for RAPDs using MEGA 5.05 (Tamura 2011). SNPs We discovered anonymous loci containing nucleotide polymorphisms (SNPs) during the process of screening microsatellites developed for other sedges for their possible utility within S. ancistrochaetus; work related to SNPs and microsatellites were performed in laboratories at Wright State University. In this study, we initially attempted to locate species-specific microsatellites for S. ancistrochaetus by amplifying S. ancistrochaetus DNA using microsatellite primers developed for two species of Scirpus L. s.l.: Schoenoplectus americanus (Pers.) Volkart ex Schinz & R. Keller (Blum et al. 2005) and Scirpus mariqueter Wang et Tang (Zhou et al. 2009), using the respective methods of each author. DNA was amplified using RedMix PLUS Taq master mix kits (GeneChoice, Inc., USA) on Eppendorf Mastercycler and BioRad i-cycler thermal cyclers. Resulting DNA fragments were visualized on agarose gels stained with EtBr. Negative controls were used to check for DNA contamination. Resulting bands were excised and purified with QIAquick Gel Extraction Kits (Qiagen, Inc.), and if necessary were amplified and gel-purified a second time (using the same primers). Purified PCR product was directly cycle sequenced using ABI Prism Big Dye terminator V 3.1 reagents (Applied Biosystems, Inc., Foster City, CA, USA), purified with Sephadex G-50 Fine powder on Multiscreen column loader plates, and run on an ABI 3730 automated sequencer (Applied Biosystems). Of the sixteen primer-pairs developed for S. americanus, three produced clean DNA sequences of a useful length: SCAM.01, SCAM.06, and SCAM.08 (Blum et al. 2005). However, 7 of these, only SCAM.01 matched the DNA region containing a microsatellite in S. americanus (though minus the repetitive motif), whereas the remaining primers amplified and sequenced novel, anonymous loci (hereafter designated SA.06a, and SA.08, respectively). Of the eight S. mariqueter primer-pairs (Zhou et al. 2009), only one (SM6) produced clean sequences of sufficient length in S. ancistrochaetus, which consisted of an anonymous locus hereafter referred to as SA.06b. We then designed new primers to specifically target each of the four products and to further screen these loci for SNPs within S. ancistrochaetus (Table 1). We chose two representatives from each of the 17 sampled sites to screen for polymorphic DNA sequences in S. ancistrochaetus. Approximately 20 ng of genomic DNA was amplified in 25μL reactions using Go Taq Green pcr Master Mix (Promega), and 1.25 μM of each forward and reverse primer. PCR was conducted on Eppendorf Mastercycler Pro thermal cyclers with an initial denaturing step of 94°C for 7 min., followed by 45 cycles of 94 °C for 20 seconds, 57 °C for 20 seconds., and 72 °C for 1 min., and a final elongation step at 72 °C for 7 min. PCR products were visualized on 1.5% agarose gels using SYBR Green (Invitrogen), magnetic-bead cleaned with Ampure (Agencourt) and sequenced using the forward primers and BigDye v. 3.1 Terminator Cycle Sequencing Kits (Applied Biosystems, Foster City, CA). The cycle-sequencing products were sephadex-cleaned and sequenced at the DNA Sequencing Facility at Yale University (New Haven, CT, USA) on an ABI 3730xl DNA Genetic Analyzer (Applied Biosystems, Foster City, CA). We constructed a haplotype network for DNA sequence data using the median-joining algorithm in NETWORK (Bandelt et al. 1999). We tested whether SNP alleles were randomly distributed among wetlands using a binomial test. For this analysis, we calculated the probability that two individuals sampled from the same wetland would have identical alleles as 8 , where pi is the frequency of the ith allele, and n is the total number of alleles. We then calculated P(x > I), where I is the number of wetlands with two identical individuals and x is the number from the binomial distribution. We assumed haploidy because we did not find any heterozygotes that would indicate that these loci were diploid; thus, our analyses were conservative. Results and Discussion In this study, we found genetic variation within the endangered species S. ancistrochaetus using two markers – RAPDs and SNPs. The presence or absence of 28 loci were scored for the three RAPD primers (OPC-06, N = 9 loci; OPC-19, N = 13 loci; OPC-20, N = 6 loci). Eighteen (64.3%) loci were polymorphic across the 17 sites, and eight (28.6%) loci were parsimony informative. On average, individuals from different sites differed from each other at 3.5 loci (range = 0–9 loci; Fig. 2). Among the four loci sequenced for these samples, only SA.06b and SA.08 were polymorphic (nucleotide diversity = 0.0041 and 0.0046, respectively). Data from both RAPDs and SNPs interestingly identified one site, Site BBG, as the most genetically distinct. For the RAPD data, Site BBG differed from all others at a mean of 6.9 loci (range = 5–9 loci), whereas the maximum number of differences between any other two sites was seven loci. For the SNP data, SA.06b contained a single polymorphic position that differentiated Site BBG from all other sites. SA.08 contained six polymorphic positions (Fig. 3), with the greatest difference being found between Site BBG and the remaining sites (five differences for each pairwise comparison). The congruence of the RAPD and SNP results in identifying the most distinct population suggests that RAPDs may be able to provide useful information about the genetic differences between populations at the coarsest scale in this species. Other studies 9 using RAPDs in conjunction with other markers have found this to be the case; for example, Longheed et al. (2000) found that RAPDs were as sufficient as microsatellites at the regional scale for analyzing population structure. The genetic uniqueness of Site BBG suggests that it might rank as a high priority when designing conservation strategies to conserve the full complement of genetic diversity within this species. For example, conservation managers may implement enhanced monitoring of Site BBG to potentially mitigate against any threats from canopy closure, herbivore damage, animal activity or invasive species, the primary threats to this species in its southern range (Cipollini and Cipollini 2011). Some evidence suggesting geographic patterns in genetic variation of populations was found with both RAPD and SNP markers. Among the eight parsimony-informative RAPD loci, the rarer of the two variants tended to be clustered geographically (Fig. 4). Likewise, Sites FH, CRB and GFT were the only sites that shared the presence or absence of all loci (Fig. 2), and these were three of the four most northern sites. These qualitative assessments suggest some evidence of isolation-by-distance; however, there was not a significant relationship between geographic distance and genetic distance at RAPD markers (Mantel test, r = 0.101, P = 0.26). There was some evidence of geographic patterns for the SNP data as well. Sites BK, 3SH, and MKR differed from the remaining 13 sites at two nucleotide positions (Fig. 3); these three sites were among the most southerly sampled sites in our data set and clustered together geographically. However, Site TM, the most southern site, was identical to the central and northern sites (Fig. 3) for SNPs and clustered with these sites for one of the rare RAPD variants (Fig. 4). Distance alone may not be a good measure of dispersal, as corridors and connectivity can influence genetic structure (Hu et al. 2010). Advances in geospatial technology and analysis will allow more detailed investigation of genetic structure and gene flow in future studies (Chan 10 et al. 2011). The habitat of S. ancistrochaetus, which is found primarily on forested ridges separated from other such ridges by agricultural landscapes, facilitates north-south dispersal along ridges rather than east-west across human-dominated valleys; therefore, genetic distance via connectivity may be more relevant than simple geographic distance for this species (e.g., Pérez-Espona et al. 2008). For SNP loci, all pairs of individuals sampled from each of the 17 wetlands shared identical alleles. Given the overall level of genetic diversity, the probability of sampling the same allele twice at every site was low (P = 0.0003 for SA.08 and P = 0.1 for SA.06b). Furthermore, the probability of sampling two copies of the rare allele from the same wetland for SA.06b was low (P = 0.003; the frequency of the rare allele squared). Thus, the distribution of alleles among wetlands deviated significantly from a random distribution for both loci; this deviation would be stronger if the loci are diploid. However, because our SNPs occur on anonymous loci, which potentially could be located on haploid chloroplast or mitochondrial DNA, our sequence data could represent only the maternal population history. To determine whether sexual reproduction is occurring and whether populations are genetically isolated, a genomic approach is required that unequivocally provides data on both maternal and paternal contributions to wetlands. However, the preliminary results from the RAPDs for one population presumably include nuclear markers, and we also failed to find variation within one wetland. Divergence between populations rather than within populations could indicate adaptation to local ecological conditions (Xie et al. 2001; Jusaitis and Adams 2005). Previous studies found no ecotypic variation in response to the environmental variable of water level (Lentz and Cipollini 1998). Regardless, the lack of genetic variation within wetlands is consistent with 11 clonal reproduction, and genetic differentiation among populations can be low for clonal plants (Honnay et al. 2006). A number of population genetic measures important for addressing conservation issues, such as effective population size, genetic diversity and genetic population structure have been difficult to quantify with adequate statistical power in this study. Our results indicate the need for developing additional nuclear DNA markers (such as SNPs) suitable for quantifying fine scale patterns of genetic diversity. To more fully understand limitations to the amount of genetic variation within individual wetland sites, more extensive within-population sampling with these sensitive nuclear DNA markers is needed. We are currently pursuing a next-gen genome sequencing study to identify additional SNPs and will use this information to study population structure in greater detail, both in Pennsylvania wetlands and in other states throughout the range of S. ancistrochaetus. Acknowledgments We thank the Pennsylvania Wild Resource Conservation Fund, Western Pennsylvania Conservancy, US Fish and Wildlife Service and Pennsylvania Natural Heritage Program for their roles in funding and otherwise supporting this research. We thank Doug Woodmansee, Don Troike and the students of BIO440-441 for their helpful comments during the development of this project. We thank Christy Clark and Philip Lavretsky for laboratory support. We thank the Pennsylvania Game Commission, Pennsylvania Department of Conservation and Natural Resources (Bureau of Forestry) and The Nature Conservancy for permission to collect plant samples. We thank Emmett and Otto Cipollini for field assistance. References 12 Amend A, Garbeletto M, Fang Z, Keeley S (2010) Isolation by landscape in populations of a prized edible mushroom Tricholoma matsutake. Cons Genet 11:795-802 Bandelt H-J, Forster P, Röhl A (1999) Median-joining networks for inferring intraspecific phylogenies. Mol Biol Evol 16:37-48 Barrett SCH, Kohn JR (1991) Genetic and evolutionary consequences of small population sizes in plants; implications for conservation. In: Falk DA, Holsinger KE (eds) Genetics and conservation of rare plants. Oxford University Press. New York, pp 3-30 Bartgis RL (1992) The endangered sedge Scirpus ancistrochaetus and the flora of sinkhole ponds in Maryland and West Virginia. Castanea 57:46–51 Blum MJ, McLachlin MJ, Saunders CJ, Herrick JD (2005) Characterization of microsatellite loci in Schoenoplectus americanus (Cyperaceae). Mol Ecol Notes 5:661-663 Bonnet E, Van de Peer Y (2002) zt: a software tool for simple and partial Mantel tests. J Stat Softw 7:1-12 Brede EG, Beebee TJC (2006) Large variations in the ratio of effective breeding and census population sizes between two species of pond-breeding anurans. Bot J Linn Soc 89:365372 Brumfield RT, Beerli P, Nickerson DA, Edwards SV (2003) The utility of single-nucleotide polymorphisms in inferences of population history. Trends Ecol Evol 18: 249–256 Carter R. 1993. Animal dispersal of the North American sedge Carex plukenetii (Cyperaceae). Am Midl Nat 129:352–356 Chan LM, Brown JL, Yoder AD (2011) Integrating statistical genetic and geospatial methods brings new power to phylogeography. Mol Phylgenet Evol 59:523-537 13 Cipollini KA, Cipollini D (2011) Habitat assessment and conservation status of endangered Northeastern bulrush. Northeast Nat 18:275-291 Eriksson O (1989) Seedling dynamics and life histories in clonal plants. Oikos 55:231-238 Esselman EJ, Jianquiang L, Crawford DJ, Windus JL, Wolfe AD (1999) Clonal diversity in the rare Calamagrostis porter subsp. inseperata (Poaceae): comparative results for allozymes and random amplified polymorphic DNA (RAPD) and intersimple sequence repeat (ISSR) markers. Mol Ecol 8:443-451 Foster JT, Allan GJ, Chan AP, Rabinowicz PD, Ravel J, Jackson PJ, Keim P (2010) Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis). BMC Plant Biol 10: 13–23. Freeland JR, Gillespie J, Ciotir C, Dorken ME (2010) Conservation genetics of Hill's thistle (Cirsium hillii). Botany 88:1073-1080 Goertzen LR, Trusty JL, Boyd RS (2011) Clonal diversity and structure in the endangered Alabama leather flower Clematis socialis Kral (Ranunculaceae). J Torr Bot Soc 138:4151 Honnay O, Jacquemyn H, Roldán-Ruiz I, Hermy M (2006) Consequences of prolonged clonal growth on local and regional genetic structure and fruiting success of the forest perennial Maianthemum bifolium. Oikos 112:21-30 Hu L-J, Uchiyama K, Shen H-L, Ide Y (2010) Multiple-scaled spatial genetic structures of Fraxinus mandshurica over a riparian–mountain landscape in Northeast China. Conser Genet 11:77-87 14 Jones CJ, Edwards KJ, Castaglione S, Winfield MO, Sala F, van de Wiel C, Bredemeijer G, Vosman B, Matthes M, Daly A, Brettschneider R, Bettini P, Buiatti M, Maestri E, Malcevschi A, Marmiroli N, Aert R, Volckaert G, Rueda J, Linacero R, Vazquez A, Karp A (1997) Reproducibility testing of RAPD, AFLP and SSR markers in plants by a network of European laboratories. Mol Breeding 3:381-390 Jusaitis M, Adams M (2005) Conservation implications of clonality and limited sexual reproduction in the endangered shrub Adanthocladium dockeri (Asteraceae). Aust J Bot 53:535-544 Lentz KA, Cipollini DF (1998) Effect of light and simulated herbivory on growth of endangered northeastern bulrush, Scirpus ancistrochaetus Schuyler. Plant Ecol 139:125-131 Lentz KA, Dunson WA (1998) Water level affects growth of endangered northeastern bulrush, Scirpus ancistrochaetus Schuyler. Aquat Bot 60:213-219 Lentz KA, Dunson WA (1999) Distinguishing characteristics of temporary pond habitat of endangered northeastern bulrush, Scirpus ancistrochaetus. Wetlands 19:162-167 Lentz-Cipollini KA, Dunson WA (2006) Abiotic features of seasonal pond habitat and effects on endangered Scirpus ancistrochaetus Schuyler. Castanea 71:271-282 Lougheed SC, Gibbs HL, Prior KA, Weatherhead PJ (2000) A comparison of RAPD versus microsatellite DNA markers in population studies of the Massasauga rattlesnake. J Hered 92:173-179 Loveless, MD, Hamrick JL (1984) Ecological determinants of genetic structure in plant populations. Ann Rev Ecol Syst 15:65-95 15 McGlaughlin ME, Friar EA (2007) Clonality in the endangered Ambrosia pumila (Asteraceae) inferred from RAPD markers; implications for conservation and management. Cons Genet 8:319-330 McLellan AJ, Prati D, Kaltz O, Schmid B (1997) Structure and analysis of phenotypic and genetic variation in clonal plants. In: De Kroon H, Van Groenendael J (eds) The Ecology and Evolution of Clonal Growth in Plants. Backhuys Publishers. Leiden, pp. 185–210 Pérez-Espona S, Pérez-Barbería FJ, McLeod JE, Jiggins CD, Gordon IJ, Pemberton JM (2008) Landscape features affect gene flow of Scottish Highland red deer (Cervus elaphus). Mol Ecol 17:981-996 Pillon Y, Qamaruz-Zaman F, Fay MF, Hendoux F, Piquot Y (2007) Genetic diversity and ecological differentiation in the endangered fen orchid (Liparis loeselii). Cons Genet 8:177-184 Primmer CR, Borge T, Lindell J and Sætre G-P (2002) Single-nucleotide polymorphism characterization in species with limited available sequence information: high nucleotide diversity revealed in the avian genome. Mol Ecol 11:603–612 Schuyler AE (1962) A new species of Scirpus in the northeastern United States. Rhodora 64:4349 Swofford DL (1999) PAUP*: Phylogenetic Analysis Using Parsimony (and Other Methods), version 4.0. Sinauer Associates, Sunderland, Massachusetts Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731-2739 16 USFWS (1991) Endangered and threatened wildlife and plants; determination of endangered status for Scirpus ancistrochaetus (northeastern bulrush). Fed Regist 56:21091–21096 USFWS (2009) Northeastern Bulrush (Scirpus ancistrochaetus) 5-year review: Summary and evaluation. State College, PA. Available online at http://ecos.fws.gov/docs/five_year_review/doc2618.pdf Vandepitte K, Roldán-Ruiz2 I, Jacquemyn H, Honnay O (2010) Extremely low genotypic diversity and sexual reproduction in isolated populations of the self-incompatible lily-ofthe-valley (Convallaria majalis) and the role of the local forest environment. Ann Bot 105: 769-776 Williams JG, Kubelik AR, Livak KJ, Raflaski JA, Tingey SV (1990) DNA polymorphism amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18:6531–6535 Xie ZW, Lu YQ, Ge S, Hong DY, Li FZ (2001) Clonality in wild rice (Oryza rufipogon, Poaceae) and its implications for conservation management. Am J Bot 88:1058-1-64 Zhou Y, Wang H, Yang M, Chen J, Zhang W (2009) Development of microsatellites for Scirpus mariqueter Wang et Tang (Cyperaceae) and cross-species amplification in Scirpus planiculmis F. Schmidt. Mol Ecol Resour 9:370-372 17 Figure Legends Fig. 1 Map of sampling sites in Pennsylvania. Fig. 2 One of 634 equally parsimonious trees constructed from RAPD loci (length = 24, consistency index = 0.75). Fig. 3 Network topology (A) and distribution of alleles (B) at locus SA.08 for 17 sampling localities. In (A), each circle indicates an allele, the area of the circle is proportional to the number of sites from which the allele was sampled, and each line separated by a square indicates a mutation separating the alleles. In (B), the color of circles corresponds to the alleles presented in (A). Note that in all cases, both individuals sampled at each site shared the same allele. Fig. 4 Distribution of variants at 8 parsimony-informative loci from four RAPD markers. Open circles indicate that a band for that locus was present; closed circles indicate the band was absent. 18 Table 1. Primers designed to amplify and sequence SNP loci for Scirpus ancistrochaetus. Locus SA.06b Primers F- CTCATGCTGCTCGGCATT R- GAAGAAGGTTCATTGGTATTGGTT SA.06a F- TTTACTTTCAGAGAAACAGGCAAC R- GACTTGCAGGAGCAATGGAT SA.08 F- CGTGTATACTCCAGCCGACA R- GGTAAGGAGGTGCAGAAGGA SA_SCAM.01 F- AGCACAAAGATCACACCTTTT R- AAGCACAAACTTGAGAAAACC 19
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )