Complete extensive parallel testing in several
advertisement
SYNTHESYS2 JRA5 Del 8.4 (60) Complete extensive parallel testing in several institutions of safe high throughput method for DNA extraction from muco-polysaccharide rich tissue with notes on general applicability. Protocols and internal primers, established in JRA5, were sent to our partner museums in London, Madrid and Vienna to be tested in the respective laboratories on the museum collections. The Natural History Museum, London, had tested a total of 240 museum curated specimens from 9 different species (including the 3 species specified in Deliverable 8.1: C.nemoralis, D. polymorpha and V. contectus). The age of the specimens ranged from 161yrs (year 1853) to freshly collected samples from 2013. Of these 49 specimens were preserved in 100% Ethanol (ETOH), 44 in HP ETOH, 7 in 95% ETOH, 55 in 80%IMS and 80 Specimens in an unknown preservant. All specimens were extracted using the Qiagen biosprint Plant Protocol and DNA restored as optimised in the laboratory in the MfN. PCr was carried out for COI (according to the protocol optimised in the MfN), 12S and 18S and all fragments were then sequenced. Where there were multiple fragments in the PCR, the fragment of interest was excised from the gel, cleaned and sequenced. Out of the 240 specimens 150 sequences were obtained. Three of which came from PCR with multiple fragments, 8 sequences worked in one direction only and 3 were contaminated. Thirteen specimens were contaminated and 79 produced no fragments for any of the markers tested. Six specimens had multiple fragments and yielded no usable sequence, while 27 specimens produced fragments but could not be sequenced. Of interest to this study, out of 44 specimens, 3 samples of D. polymorpha, collected in 1998, produced the full COI sequence. Internal primers for this species worked on 6 specimens producing the full barcoding region, and for 8 specimens 2 out of the 3 internal primers were successful. In total, 44 specimens of C. nemoralis were tested. The full COI barcoding region was obtained from 7 specimens,collected in 1964 and 2013, using primers COI-L and COI-H. The full fragment was also obtained using the internal primers designed in the MfN on 3 more specimens, collected in 1964. Twenty-three samples failed to amplify any of the markers and 16 produced either a single internal fragment or 2 internal fragments. Only two specimens of V. contectus specimens were tested and neither produced any fragments from any markers. As the museum in Madrid did not have comparable specimens to those tested in the museum in Berlin a direct comparison of protocol cannot be made. However, molluscs preserved using 96% Ethanol (Pseudamnicola meloussensis), 70% ethanol (Pseudamnicola sp. Pseudamnicola navariana) and dried specimens (Margaritifera, Pseudamnicola astieri, Pecten jacobaeus, Pseudamnicola marisolaeUnio aegyptiacus, Unio littoralis, Unio wolwichi, Unio elongatulus, Unio mucidus,Unio pseudolittoralis) were extracted using the silica (Alda et al.,2007) and a 413bp 18S rRNA fragment was amplified and sequenced. It was found that specimens preserved in 96% ethanol (collected in 2007) successfully amplified and sequenced the 18S rRNA fragment. Samples preserved in 70% ethanol (collected in 1984 and 1993) did not amplify the 18S fragment. Of the 27 dried sampled (collected from 1961-1989) 24 samples yielded the 18S sequence. However 10 of those samples, belonging to Pseudamnicola marisolae produced a double sequence with diatoms. The museum in Vienna were able to test 20 individuals of C. nemoralis, 32 individuals of D. polymorpha, 4 individuals of V. contectus (due to a limited number of sepcimens in the collection) and 12 indiviuduals of V. acerosus. In addition to this, 16 additional taxa covering the whole phylum Mollusca with a strong focus on land gastropods (12 taxa) were analysed as well. The age of the specimens ranged from 1877 to 2002. As the option of using the Qiagen-Biosprint was unavailable, two different methods of extraction was used : Gen-ial First DNA, All-tissue DNA-Kit (small forensic material-protocol) and Promega, Tissue and Hair Extraction Kit (for use with DNA IQ). In addition to the full barcoding primer pair and the 3 internal primer pairs designed for the 3 species, an alternative COI primer pair (Duda et al., 2011) and universal primers yielding a 350bp 16S rRNA fragment was used. The results showed that both extraction kits yielded PCR products, but the Gen-ial-Kit works slightly better. This was found throughout all taxa and with all primer sets. DNA extracted from Dreissena sp. resulted in successful amplification with all tested primers, except the 16S-primer. Cepaea nemoralis resulted in only 42% positive reactions in total, especially the third primer pair (HCOvar/Int3f_nem) and the long COI sequence were problematic for this species. The worst results showed Viviparus with only 14% of positive reactions. All five tested primer sets did not work well in this species. Interestingly, the gastropod taxa worked best of all the remaining mollusc taxa, especially the snail species, while the slugs turned out to yield mostly bad results. Sometimes the long COI sequence could not be obtained, but the 16S primers worked in 73% of the reactions, no matter if the taxa were terrestrial, aquatic or marine. Interestingly, the slugs emerged to be very problematic concerning DNAextraction and/or primer annealing. The PCR reactions of the chosen slug taxa resulted only in 10% positive reactions. Of the remaining taxa the analysed marine bivalve and the cephalopod worked sparsely with both tested primer sets. Finally, the polyplacophoran taxon showed positive results in 85% of all reactions. It was observed that DNA extracted from samples collected after 1900 could still be amplified compared to samples collected earlier. From the oldest individuals (from 1877) sampled: Limax maximus and Viviparus acerosus (two specimens of each species) only one positive reaction for L. maximus and no positive reaction for V. acerosus (all primer sets). In general the results have proved to be promising. Firstly, a highthroughput extraction method can be applied to mucopolysaccharide-rich tissue. The DNA obtained from this method did yield viable sequences from specimens as old as 1964. In addition, the method of extraction doesn’t seem to have a direct impact on the DNA obtained, as seen with the samples processed in Vienna.Secondly, internal fragments worked to a certain degree, producing the full 660bp fragment or at least up to 400bp of the COI region. Further optimisation or perhaps even redesigning one of the internal primer pairs would be necessary. Finally, protocols and primers desgined in the MfN, Berlin, could be applied to other laboratories on similar museum specimens, which was one of the key deliverables set out for this particular Joint Research Activity. Appendix 1: NHM London JRA5 report General: We took tissue samples from 240 specimens including a range of samples from the three target organisms and extracted DNA from each animal twice. Only one lot was available for Viviparus contectus. Other taxa include land snails, marine snails and a few marine bivalves spanning the range of interests at the NHM. Some names are for new species, and not yet published. We tried to amplify COI using a variety of primers for each specimen and a range of PCR protocols. When COI failed we also tried to amplify other genes (12S or 18S) to test whether the DNA was good, even if the primers failed. The oldest sample for which we obtained COI sequence was a sample of Cepaea nemoralis collected sometime on or before 1964 (the specimen was registered in 1964, but the collection date was not given on the label). Please note that very few samples (other than material collected in the 2000’s) have been preserved for molecular analyses. Samples preserved prior to 2000 may have been first preserved in formalin and then transferred to IMS or ethanol. This is not noted on the label. Lisa listed how well tissue samples were digested during the extraction and this may give some hint of the preservation (formalin-preserved samples do not digest well). The samples used (SYN1- SYN240) are detailed in the excel sheet attached. Page 2 of the same spreadsheet summarises the results. METHODS Extraction: Extractions were carried out as per the protocol, with the exception that the tissue samples were blotted dry on a piece of clean Kimwipe rather than being left to air dry on a piece of Parafilm. DNA restoration carried out as per the protocol to give a final volume of 25μl restored DNA. PCR: The PCR recipe given in the protocol was adapted as follows: H20 10x Buffer (NEB) 10mM dNTPs 10μM Primer F 10μM Primer R 25mM MgCl2 (Qiagen) 10x BSA (NEB) Taq (NEB) Restored DNA 10.3μl 2.5μl 0.5μl 1.0μl 1.0μl 0.5μl 2.0μl 0.2μl 2.0μl Where internal primers were used, the volume of MgCl2 was increased to 1.0μl; where the 12S primers (12S-I/12S-III) were used, it was increased to 1.5μl. The 10x BSA was not included where product was reamplified, the reaction volume being made up with additional water. Product used for reamplification was diluted 1:10 Thermocycler conditions: For COI (LCO1490/HCOvar; LCOmod/HCOmod; COI-L/COI-H; COI-F/COI-R; T=45) and 12S (12S-I/12S-III; T=50): 94°C 94°C T°C 72°C 72°C 4°C 3 mins 45 sec 45 sec 2 mins 10 mins ∞ X40 cycles For internal COI (LCO1490/int1_nem; int2f_nem/int2r_nem; int3f_nem/HCOvar; LCO1490/int1_drei; int2f_drei/int2r_drei; int3f_drei/HCOvar; COI-L/COI_1R; COI_2F/COI_2R; COI_3F/COI-H): 94°C 94°C 45°C 72°C 72°C 4°C 3 mins 30 sec 30 sec 90 sec 5 mins ∞ X40 cycles Following PCR, the samples were run out on a gel and those that showed a band were sent for sequencing. Where multiple bands were observed, the desired band was cut from the gel and purified using GeneClean prior to sequencing. Participants: Tissue samples were chosen by Jon Ablett, Andrea Salvador, David Reid, John Taylor and Suzanne Williams. All lab work was undertaken by Lisa Smith. Management of the project at the NHM by SW. Appendix 2: CSIC MNCN Madrid JRA5 report SYNTHESYS II JR5. CSIC MNCN Marian Ramos Isabel Rey Molecular methods Alcohol preservation and dry specimens and operculum extraction was carried out with DNA extraction methods that use silica to bind DNA Alda et al. (2007). A 413 base pair (bp) region of the 18S ribosomal RNA (18S rRNA) sequence was amplified with the primers 18S-1F (5’-TACCTGGTTGATCCTGCCAGTAG-3’) and 18S-3F (5’- AGGCTCCCTCTCCGGAATCGAAC -3’) (Giribert 1996) for all specimens. 3 l of the DNA solution was used as a template. Other components of the 25 l PCR reaction were: 1x of the corresponding buffer (75 mM Tris HCl, pH 9.0; 50 mM KCl and 20 mM (NH4)2SO4), 2 mM MgCl2), 10 mM dNTPs mix, 0.1 M of both primers, 0.02% BSA, and 0.125 units AmpliTaq Gold® DNA Polymerase (Applied Biosystems). Six microlitres of PCR products were electrophoreses through a 1.5% agarose gel and visualized with SYBR Safe™ DNA Gel Stain (invitrogen) under ultraviolet light. PCR products were purified by treatment with ExoSAP-IT (USB Amersham, Buckinghamshire, UK) and incubated at 37ºC for 45 min, followed by 80ºC for 15 min to inactivate the enzyme. Purified PCR product was then used to sequence in both directions using the BigDye Terminator v3.1 sequencing kit (Applied Biosystems Inc., Foster City, USA). The sequences obtained were compared with sequences from GenBank, to verify that the sequence came from a mollusc, using blast (Altschul et al., 1997) and with our alignment of sequences generated of Pseudamnicola genus (unpublished). The alignment of all sequences generated in our lab was done and edited manually using MEGA 5.04 (Tamura et al., 2011). Results The results of amplification and sequencing can be seen in Table 1.When the amplification was positive, around of 400 base pair (bp) region of the 18S rRNA were sequenced. The negative amplifications were repeated 3 times (18S rRNA) with the same result, should be tested amplification of other fragments. Table 1: The table shows the specimens used, the form of preservation, collection date and the results of amplification and sequencing. (*) Double DNA sequences with Pseudamnicola DNA and diatoms DNA Mollusk Collection DNA Collection Specie Preservation Extraction Date Amplification Sequentiation number MNCN 15.05/42057 MNCN 15.05/42057 MNCN 15.05/42057 MNCN 15.05/42057 MNCN 15.05/42057 MNCN 15.07/1484 MNCN 15.07/1540 MNCN 15.07/529 MNCN 15.07/454 MNCN 15.07/314 MNCN 15.07/586 FW-22 FW-22 FW-22 FW-22 FW-22 FW-22 MNCN 15.07/191 MNCN 15.07/5191 MNCN 15.07/7116 FW-494 FW-494 FW-494 FW-494 FW-494 FW-494 FW-494 FW-494 FW-494 FW-494 FW-803 FW-803 FW-803 FW-803 FW-803 FW-1856 FW-1856 FW-1856 FW-1856 FW-1856 number MNCN:ADN:54902 MNCN:ADN:54903 MNCN:ADN:54904 MNCN:ADN:54905 MNCN:ADN:54906 MNCN:ADN:63272 MNCN:ADN:63273 MNCN:ADN:63274 MNCN:ADN:63275 MNCN:ADN:63276 MNCN:ADN:63280 MNCN:ADN:63277 MNCN:ADN:63278 MNCN:ADN:63278 MNCN:ADN:63281 MNCN:ADN:63286 MNCN:ADN:63287 MNCN:ADN:63282 MNCN:ADN:63288 MNCN:ADN:63283 MNCN:ADN:63290 MNCN:ADN:63291 MNCN:ADN:63292 MNCN:ADN:63295 MNCN:ADN:63296 MNCN:ADN:63297 MNCN:ADN:63298 MNCN:ADN:63299 MNCN:ADN:63300 MNCN:ADN:63301 MNCN:ADN:63302 MNCN:ADN:63303 MNCN:ADN:63304 MNCN:ADN:63305 MNCN:ADN:63306 MNCN:ADN:63307 MNCN:ADN:63308 MNCN:ADN:63309 MNCN:ADN:63310 MNCN:ADN:63311 MNCN:ADN:63312 MNCN:ADN:63313 MNCN:ADN:63314 Pseudamnicola astieri Pseudamnicola astieri Pseudamnicola astieri Pseudamnicola astieri Pseudamnicola astieri Pecten jacobaeus Pecten jacobaeus Pecten jacobaeus Unio aegyptiacus Cailliaud, 1827 Unio littoralis Cuvier in 1798 Unio wolwichi Morelet, 1845 Unio elongatulus C. Pfeiffer, 1825 Unio mucidus Morelet 1845 Unio pseudolittoralis Clessin, 1875 Pseudamnicola sp. Pseudamnicola sp. Pseudamnicola sp. Pseudamnicola sp. Pseudamnicola sp. Pseudamnicola sp. Margaritifera Margaritifera Margaritifera Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola marisolae Pseudamnicola navariana Pseudamnicola navariana Pseudamnicola navariana Pseudamnicola navariana Pseudamnicola navariana Pseudamnicola meloussensis Pseudamnicola meloussensis Pseudamnicola meloussensis Pseudamnicola meloussensis Pseudamnicola meloussensis Dry Dry Dry Dry Dry Dry Dry Dry Dry Dry Dry Dry Dry Dry Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 70% Dry Dry Dry Seco Seco Seco Seco Seco Seco Seco Seco Seco Seco Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 70% Ethanol 96º Ethanol 96º Ethanol 96º Ethanol 96º Ethanol 96º Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Ligament Ligament Ligament Ligament Ligament Ligament Ligament Ligament Ligament Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Ligament Ligament Ligament Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Entire specimen Operculum Operculum Operculum Operculum Operculum Operculum Operculum Operculum Operculum Operculum 6-1961 6-1961 6-1961 6-1961 6-1961 7-2004 7-2004 7-2004 + 50 years old + 50 years old + 50 years old + 50 years old + 50 years old + 50 years old 07-11-1984 07-11-1984 07-11-1984 07-11-1984 07-11-1984 07-11-1984 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 17-10-1989 16-04-1993 16-04-1993 16-04-1993 16-04-1993 16-04-1993 8-1-2007 8-1-2007 8-1-2007 8-1-2007 8-1-2007 Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Negative Negative Negative Negative Negative Negative Negative Negative Negative Negative Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Positive Negative Negative Negative Negative Negative Positive Positive Positive Positive Positive Ok Ok Ok Ok Ok Ok Ok Ok DNA of genus Platanus DNA of genus Platanus DNA of Cyanophyta DNA of Cyanophyta DNA of Cyanophyta Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok (*) Ok Ok Ok Ok No work References Alda F.; Rey, I.; Doadrio, I. 2007. An improved method of extracting degraded DNA samples from birds and other species. Ardeola 54(2): 331-334 Altschul SF, Madden TL, Schaeffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped blast and psi-blast: a new generation of protein database search programs. Nucleic Acids Research 25: 3389-3402. Giribet, G., et al. (1996). First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Molecular Biology and Evolution 13(1): 76-84. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739. Appendix 3: NHM Vienna JRA5 report Report on SYNTHESYS 2, Joint research activity 5 (DNA extraction from alcohol preserved mucopolysaccharide-rich taxa) Katharina Jaksch Coordinators: Anita Eschner & Elisabeth Haring Museum of Natural History, Burgring 7, 1010 Wien katharina.jaksch@nhm-wien.ac.at Experimental Setting The DNA extraction method initially planned to be used for this project is based on the Qiagen Biosprint-Kit. It could, however, not be used for our part of the project as the equipment cannot be purchased any more. Thus, it was decided to test two alternative extraction methods. Both of them are frequently used in our laboratory and one (Promega) is especially dedicated to forensic samples. The initial task of the leading group at the MFN Berlin (according to the budgeted costs) was to analyse six full plates (576 extractions). Starting with this number of extractions to be analysed and under the condition to compare two different extraction methods and that every individual should have a replicate sample, we analysed 72 different glasses (144 individuals respectively) of molluscs. Of each individual 2 tissue samples were taken, each of them was processed with the two extraction methods (this means: 2 individuals/glass x 2 tissue samples x 2 extraction-kits x 72 = 576 extractions in total). Samples According to the general setting of the project the following three taxa should be used preferentially: Cepaea nemoralis, Dreissena polymorpha, and Viviparus contectus. We analysed 20 individuals of C. nemoralis and 32 individuals of D. polymorpha. For V. contectus we had to face the problem that our collection does not contain as much samples of this species as we had expected. Furthermore, several of them were empty shells and, therefore, could not be included in this study. Finally, only four individuals of V. contectus were analysed, but we substituted this species with Viviparus acerosus (12 individuals). Besides the three main taxa we chose in addition 16 taxa covering the whole phylum Mollusca with a strong focus on land gastropods from which we obtained altogether 12 taxa (complete table of samples see Tab. 1). The collecting date of the chosen samples ranges from 1877 to 2002. Tab. 1: List of taxa and material analysed. Each line corresponds to one glass. Collection (NHMW) number, formaldehyde concentration in mg/l, and collecting date are given. (+) means that the given year is the time of determination, while no collection date known. Two individuals per glass were analysed, total number of individuals analysed is given in parentheses when species is first mentioned. 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 1 6 1 7 1 8 1 9 2 0 2 1 2 2 2 3 2 4 2 5 2 6 2 7 2 8 (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) (Linné, 1758) Nr. NHMW 016017 019158 019185 023361 023362 025276 77921 74401 79088 Formol [mg/l] 0 0 0 >>100 0 0 0 0 0-10 Coll. Date 1889 (+) 1892 1892 1895 1895 1897 1972 1973 1973 nemoralis (Linné, 1758) 87076 0 1974 Dreissena polymorpha (32) (Pallas, 1771) 019505 0 1891 Dreissena polymorpha (Pallas, 1771) 019513 0 1891 Dreissena polymorpha (Pallas, 1771) 83846 0 1994 Dreissena polymorpha (Pallas, 1771) 83847 0 1994 Dreissena polymorpha (Pallas, 1771) 89911 0 1994 Dreissena polymorpha (Pallas, 1771) 89907 0 1994 Dreissena polymorpha (Pallas, 1771) 89905 0 1994 Dreissena polymorpha (Pallas, 1771) 89906 0 1994 Dreissena polymorpha (Pallas, 1771) 101710 0 1991 Dreissena polymorpha (Pallas, 1771) 101711 0 1991 Dreissena polymorpha (Pallas, 1771) 101850 0 1991 Dreissena polymorpha (Pallas, 1771) 019538 0 1892 Dreissena polymorpha (Pallas, 1771) 84428 0 1985 Dreissena polymorpha (Pallas, 1771) 248 0 1950 (+) Dreissena polymorpha (Pallas, 1771) 101721 0 1991 Dreissena polymorpha (Pallas, 1771) 55324 40-60 1924 Viviparus contectus (4) (Millet, 1813) 51317 0 1918 (+) Viviparus contectus (Millet, 1813) 101694 10 Genus Species Author Species Cepaea Cepaea Cepaea Cepaea Cepaea Cepaea Cepaea Cepaea Cepaea nemoralis (20) nemoralis nemoralis nemoralis nemoralis nemoralis nemoralis nemoralis nemoralis Cepaea 1991 2 9 3 0 3 1 3 2 3 3 3 4 3 5 3 6 3 7 3 8 3 9 4 0 4 1 4 2 4 3 4 4 4 5 4 6 4 7 4 8 4 9 5 0 5 1 5 2 5 3 5 4 5 5 5 6 5 Viviparus acerosus (12) (Bourguignat, 1862) 102198 >>100 1992 Viviparus acerosus (Bourguignat, 1862) 102197 >>100 1992 Viviparus acerosus (Bourguignat, 1862) 77197 0 1969 Viviparus acerosus (Bourguignat, 1862) 77201 0 1969 Viviparus acerosus (Bourguignat, 1862) 101984 0 2002 Viviparus acerosus (Bourguignat, 1862) 72362 0 1877 Aegopis verticillus (4) (Lamarck, 1822) 73992 0-10 1912 Aegopis verticillus (Lamarck, 1822) 025272 0 1897 Arianta arbustorum (6) (Linné, 1758) 89915 0 1989 Arianta arbustorum (Linné, 1758) 86813 0 1991 Arianta arbustorum (Linné, 1758) 100810 0 1992 Helix pomatia (6) Linné, 1758 74149 0 1891 Helix pomatia Linné, 1758 101290 0 1993 Helix pomatia Linné, 1758 74402 0 1973 Genus Species Author Species Nr. NHMW Formol Coll. [mg/l] Date Lymnaea stagnalis (4) (Linné, 1758) 86667 0 1987 Lymnaea stagnalis (Linné, 1758) 101939 0 1997 Lyncina carneola (4) (Linné, 1758) 037237 0 1897 Lyncina carneola (Linné, 1758) 037238 0 1897 Nerita polita (4) Linné, 1758 037296 0 1897 Nerita polita Linné, 1758 037298 0 1897 Planorbis planorbis (6) (Linné, 1758) 86703 0 1991 Planorbis planorbis (Linné, 1758) 86681 0 1990 Planorbis planorbis (Linné, 1758) 84060 0 1985 Aplysia dactylomela (6) Rang, 1828 73532 0 1955 (+) Aplysia dactylomela Rang, 1828 73533 0 1955 (+) Aplysia dactylomela Rang, 1828 021012 0 1958 Arion subfuscus (6) (Draparnaud, 1805) 100806 0 1999 Arion subfuscus (Draparnaud, 1805) 031599 0 1885 Arion subfuscus (Draparnaud, 1805) 031600 0 1886 7 5 8 5 9 6 0 6 1 6 2 6 3 6 4 6 5 6 6 6 7 6 8 6 9 7 0 7 1 7 2 Deroceras reticulatum (4) (Müller, 1774) 45139 0 1908 Deroceras reticulatum (Müller, 1774) 31593 0 1886 Limax cinereoniger (4) Wolf, 1803 33545 0 1900 Limax cinereoniger Wolf, 1803 77517 0 1926 Limax maximus (6) Linné, 1758 031576 0 1885 Limax maximus Linné, 1758 031574 0 1886 Limax maximus Linné, 1758 77545 0 1877 Malacolimax tenellus (4) (Müller, 1774) 031587 0 1885 Malacolimax tenellus (Müller, 1774) 031588 0 1885 Mimachlamys varia (4) (Linné, 1758) 87212 0 1969 Mimachlamys varia (Linné, 1758) 021777 0 1894 Sepia plangon (4) Gray, 1894 55206 0 1884 Sepia plangon Gray, 1894 015467 0 1884 Acanthopleur a brevispinosa (4) (Sowerby, 1840) 37333 0 1895 Acanthopleura brevispinosa (Sowerby, 1840) 37334 0 1895 Formaldehyde concentration Currently another study is performed at the NHMW concerning the impact of storage conditions and ethanol-amount as well as formaldehyde concentration on the quality of DNA in the material and its possible use for DNA analyses (SCHILLER et al., in prep.). Therefore, we also measured the formaldehyde concentration in all our samples by a simple calorimetric test. DNA extraction with two different extraction kits Two small pieces of tissue were cut off from peripheral regions of each animal’s body. Before extraction, samples were air dried to remove remaining ethanol. A) Gen-ial First DNA, All-tissue DNA-Kit (small forensic material-protocol) The tissue was mixed with 220 µl Lysis Buffer and 5 µl Proteinase K solution (Proteinase K 20mg/μl) and incubated over night at 65°C. On the next day a final lysis step and several washing and precipitation steps were performed. Finally, the DNA was eluted in 40 µl elution buffer. B) Promega, Tissue and Hair Extraction Kit (for use with DNA IQ) The tissue was mixed with 100 µl of incubation solution (incubation buffer : DTT [1 M] : Proteinase K [18mg/ml] = 8: 1: 1) and incubated over night at 56°C. Lysis starts on the next day by adding 200 µl lysis buffer and 7 µl of resin. After several washing steps DNA was eluted in 40 µl elution buffer. PCR amplification and primers For Cepaea, Dreissena and Viviparus primer sequences for three short (overlapping) sections of the mitochondrial (mt) COI sequence were provided by the lab at the MFN (LCO1490, HCOvar, Int1_nem, Int2f_nem, Int2r_nem, Int3f_nem, Int_1drei, Int2f_drei, Int2r_drei, Int3f_drei, Viv_int1R, Viv_int2F, Viv_int2R, Viv_int3F) which amplify an approximately 660 bp sequence of the mt COI gene (Tab. 2). These primers were specifically designed for the three main taxa, therefore, alternative COI primers were used for the other taxa that amplify a 650 bp sequence (COIfolmerfwd, COI_schneckrev, DUDA et al. 2011). Interpretation of results is hampered by the fact that shorter fragments are easier to amplify than longer sequences and the 650 bp section is for some samples clearly above the amplification limit. For individuals negative with that primer pair it should be tested whether smaller fragments could be amplified. Yet, the short internal primers were only suitable for Cepaea, Dreissena and Viviparus. To test with the COI as a marker whether samples that proved to be negative with the 650 bp fragment could yield smaller PCR products in the other taxa it would have been necessary to do a lot of primer design and testing. This would have exceeded by far the budget of the project. Therefore, we tested all samples with universal primers for a short section of the mt 16S rRNA gene (~350 bp). These primers are universal and amplify well in all taxa analysed. Tab. 2: List of all used Primer sequences. The taxa analysed with the primer is given and the annealing temperature for each primer used in the PCR analyses. Primer name Primer Sequence (5’-3’) Taxa used LCO1490 HCOvar Int1_nem Int2f_nem Int2r_nem Int3f_nem Int_1drei Int2f_drei Int2r_drei Int3f_drei Viv_int1R Viv_int2F GGTCAACAAATCATAAAGATATT TAWACTTCTGGGTGKCCAAARAAT GCTCAGATTGTTCATCCGAGG GGTTCCACTGCTTGTAGGAGC CCCCAAAATTGAAGAAACACCCG GCGTCCGTTGACTTGGCCATT YCTTACATTATTWARACGAGG GGTYCCRATAATACTTAAGTCTT GGCACGTATATTWCCTCATGTYC AGCTTCTTCWATTATRGCTTC AAATGCTATATCAGGAGCGCC ATTGGTGGGTTTGGTAATTGGC ATAGAAGAAGCCCCAGCTAAATG CA GGCTCATGCTGGAGGTTCTGTAGA GGTCAACAATCATAAAGATATTGG TATACTTCTGGATGACCAAAAAAT CA CGCAGTACTCTGACTGTGC CGCCGGTCTGAACTCAGATC Cep., Drei., Viv. Cep., Drei., Viv. Cepaea Cepaea Cepaea Cepaea Dreissena Dreissena Dreissena Dreissena Viviparus Viviparus Annealing temperature 43°C 43°C 43°C 43°C 43°C 43°C 43°C 43°C 43°C 43°C 43°C 43°C Viviparus 43°C Viviparus All samples 43°C 56°C All samples 56°C All samples All samples 50°C 50°C Viv_int2R Viv_int3F COIfolmerfwd COIschneckrev 16S_sch_fwd 16S_sch_rev The PCR conditions and polymerases were tested in the beginning of the project and not changed afterwards. PCR for all COI amplifications was performed with the Phusion-Kit (High-Fidelity DNA Polymerase; Finnzymes), for 16S the TopTaqPolymerase-Kit (Qiagen) was used. Phusion-Mastermix per reaction (12,5 µl): Reagent Water AD 5x Phusion GC Buffer 10mM dNTP’s Primer_fwd [50pmol] Primer_rev [50pmol] Phusion DNA Polymerase 2U/µl DNA Volume [µl] 8,875 2,5 0,25 0,125 0,125 0,125 0,5 TopTaq-Mastermix per reaction (12,5 µl): Reagent Water AD Q-Solution (5x) TopTaq PCR Buffer 10x 10mM dNTP’s Primer_fwd [50pmol] Primer_rev [50pmol] TopTaq DNA Polymerase 5U/µl DNA Thermocycler conditions Phusion: Temperature [°C] [ m i n ] 0 0 : 3 0 00:10 98 98 48 (short)/ 56 (big) 72 72 10 T i m e x 40 cycles 00:30 00:30 0 7 : 0 0 h o l d Thermocycler conditions TopTaq: Volume [µl] 7,7 2,5 1,25 0,25 0,125 0,125 0,05 0,5 Temperature [°C] 94 94 50 72 72 10 Time [min] 04:00 x 35 cycles 00:30 00:30 01:00 07:00 hold Preliminary results A detailed list of results can be found in a separated Excel-file. Comparing the three main taxa Dreissena worked best (58% positive in total) with both extraction methods as well as with all tested primers, except the 16S-primer. These seem to be problematic for bivalves in general as Mimachlamys also did not work in 16S. Cepaea resulted in only 42% positive reactions in total, especially the third primer pair (HCOvar/Int3f_nem) and the long COI sequence were problematic for this species. The worst results showed Viviparus with only 14% of positive reactions. All five tested primer sets did not work well in this species. The gastropod taxa worked best of all the remaining mollusc taxa, especially the snail species, while the slugs turned out to yield mostly bad results. Sometimes the long COI sequence could not be obtained, but the 16S primers worked in 73% of the reactions, no matter if the taxa were terrestrial, aquatic or marine. Interestingly, the slugs emerged to be very problematic concerning DNA-extraction and/or primer annealing. The PCR reactions of the chosen slug taxa resulted only in 10% positive reactions. Of the remaining taxa the analysed marine bivalve and the cephalopod worked sparsely with both tested primer sets. Finally, the polyplacophoran taxon showed positive results in 85% of all reactions. The comparison of the two different extraction kits shows, that both yield PCR products, but the Gen-ial-Kit works slightly better (Tab. 3). This was found throughout all taxa and with all primer sets. An effect of the age on the DNA conservation can be observed, as the samples collected before 1900 worked inferior to the samples after 1900. Concerning the Cepaea nemoralis samples the amount of positive reactions clearly decreased with the age of the samples. The oldest individuals (from 1877) were Limax maximus and Viviparus acerosus (two specimens of each species) and resulted in only one positive reaction for L. maximus and no positive reaction for V. acerosus (all primer sets). This could simply be a consequence of the age, but it should be considered that also problems of primer specificity could lead to (or contribute to) such results. This assumption is supported by the fact that several other taxa of about the same age, e.g. Acanthospleura brevispinosa – 1895, worked very well. However, concerning the troubles in Viviparus, conservation methods could have led to a higher degradation of DNA in these samples. Viviparids close their shell with an operculum, which may hamper ethanol intruding the shell to fix the tissue immediately. The concentration of formaldehyde did not seem to have a strong effect on amplification success, except really high concentrations. Although, these observations are based on only a few samples in which formaldehyde could be detected at all (10 samples in total), they are noteworthy. Tab. 3: Positive PCR-results for all used primer sets [%]. Primerset Primerset_1 Primerset_2 Primerset_3 COI_big 16S_sch Promega-Kit [% positive] 50,4 % 36,3 % 46,7 % 37,4 % 51,9 % Genial-Kit [% positive] 47,1 % 55,9 % 52,2 % 46,3 % 72,3 % Conclusion The experimental setting included several factors (e.g, taxon, age, fixation, conservation, extraction, primer specificity) that might influence the results in various ways and degrees. The reasons for the fact that some taxa performed generally bad (Viviparus, Aplysia, slugs) cannot be definitely drawn from the results: Several factors, e.g., age, high content of mucopolysaccharides, primers, might contribute to various extent to these results. However, some trends appear substantial: (1) PCR success is correlated with the extraction method used. (2) There is an age dependence, with success decreasing with age of the sample. However, this correlation is not linear. Each sample has its individual history which might have influenced its DNA quality, thus, age alone is a bad predictor of PCR success. References DUDA, M., SATTMANN, H., HARING, E., BARTEL, D., WINKLER, H., HARL, J. & KRUCKENHAUSER, L. (2011). Genetic differentiation and shell morphology of Trochulus oreinos (Wagner , 1915 ) and T. hispidus (Linnaeus, 1758) (Pulmonata: Hygromiidae) in the northeastern alps. Journal of Molluscan Studies, 77, 30– 40. doi:10.1093/mollus/eyq037 Appendix 4: Results See http://www.synthesys.info/joint-research-activities/synthesys-2-jras/jra5- development-of-high-throughput-methods-for-dna-isolation-from-invertebrates-withmuco-polysaccharide-rich-tissue-home-page/ for full list of results.
