The NIa gene of Papaya ringspot virus is the host determinant for papaya infection
Kuan-Chun Chen, Fang-Lin Liu, Ching-Hsien Wang, Wei-Chih Su, Shyi-Dong Yeh
Department of Plant Pathology, National Chung Hsing University, Taichung, Taiwan 402,
R.O.C.
Correspondence author: Shyi-Dong Yeh
Telephone 886-4-22877021
Fax:886-4-22852501
Email :sdyeh@nchu.edu.tw
Running title: the host determinant for papaya infection
Number of total words in text: 3266 words
Summary: 230 words
Number of total tables and figures: 6
1
Abstract
Most of the strains of Papaya ringspot virus (PRSV), a member of Potyvirus, belong
to type W (PRSV W) or type P (PRSV P). PRSV W causes severe loss on cucurbits
worldwide while PRSV P is devastating on papaya in tropical and subtropical areas. The
host range of PRSV W is limited in plants of Chenopodiaceae and Cucuribitaceae, while
PRSV P infects plants of Caricaceae (papaya family) in addition.
In order to investigate
the host determinant for papaya infection, the infectious cDNA clones of PRSV P-YK and
W-CI were constructed to generate type P and type W viruses, respectively.
Exchanges at
various regions between P-YK and W-CI genomes were conducted at the cDNA level.
The recombinant clones were mechanically introduced to papaya seedlings and plants of
Chenopodium quinoa. The fidelities of the recombined viruses were verified by reverse
transcription-polymerase chain reaction coupled with restriction enzyme digestion. All
P-YK recombinants with an exchanged W-CI NIa gene lost the ability to infect papaya,
whereas all W-CI recombinants with an exchanged P-YK NIa gene became
papaya-infecting.
Based on the results, we conclude that the region of nts 6509-7700 of
PRSV, which covers the nuclear inclusion a (NIa) gene, is the host determinant for papaya
infection. Sequence comparison between two type P and two type W viruses suggests that
the two amino acid changes at the NIa gene are critical for the host specificity.
2
Introduction
Papaya (Carica papaya L.) is widely grown in tropical and subtropical areas. The
destructive papaya ringspot disease, caused by Papaya ringspot virus (PRSV), is a major
obstacle to large-scale commercial production of papaya (Purcifull et al., 1984).
PRSV is
a member of the genus Potyvirus in the family Potyviridae, the largest and economically
most important plant virus genus, (Francki et al., 1991).
nonpersistent manner in nature (Purcifull et al., 1984).
particles of 780×12 nm in size.
It is transmitted by aphids in a
Virions of PRSV are flexuous
The genome consists of a single-stranded RNA of positive
polarity (De La Rosa & Lastra, 1983, Purcifull et al., 1984). PRSV has a coat protein (CP)
subunit of 36,000 dalton (36 kDa) (Gonsalves & Ishii, 1980, Purcifull & Hiebert, 1979) and
induces both cylindrical inclusion protein (CIP) (Purcifull & Edwardson, 1967) and
amorphous inclusion protein (AIP) (Martelli & Russo, 1976) in the cytoplasm of host cells.
Most strains of PRSV were classified in one of the two major groups, type W viruses
(PRSV W, formerly known as Watermelon mosaic virus 1, WMV-1, non-papaya infecting)
and type P viruses (PRSV P, papaya infecting) (Purcifull et al., 1984).
The PRSV type W
and type P were distinguished by host range. PRSV W viruses only infect
Chenopodiaceae and Cucurbitaceae.
In addition to the two families, PRSV P viruses also
infect plants in Caricaceae (Purcifull et al., 1984, Yeh et al., 1984).
PRSV W was first described as Watermelon mosaic virus 1 (WMV-1) infecting
cucurbits (Webb & Scott, 1965), and considered for a long time as a distinct potyvirus.
However, WMV-1 and PRSV isolates are serologically indistinguishable when tested
against antibodies prepared to viral particles (Gonsalves & Ishii, 1980), coat protein (CP)
(Yeh et al., 1984), cylindrical inclusion proteins (CIPs) (Yeh & Gonsalves, 1984b), and
amorphous inclusion proteins (AIPs) (De Mejia et al., 1985, Yeh & Gonsalves, 1985).
Furthermore, the mild strain of PRSV is able to cross-protect cucurbits against PRSV and
3
WMV-1 (Yeh & Gonsalves, 1984a), and genes in cucurbits resistance to WMV-1 also
conferr resistance to PRSV (Provvidenti & Gonsalves, 1982, Yeh et al., 1984). Based on
the similarities in serological properties, cross-protection, and host resistance, WMV-1 is
therefore reclassified as a specific pathotype of PRSV, designated as PRSV W virus, and the
papaya infecting PRSV isolates as PRSV P virus (Purcifull et al., 1984, Yeh et al., 1984).
According to different symptoms induced on papaya, the PRSV P viruses are further
divided into wilting type and mosaic type (Chang, 1979).
In Taiwan the mosaic inducing
PRSV P viruses are most common (Chang, 1979).
The variations among PRSV CP genes worldwide are related to geographic region, not
host range (Bateson et al., 1994, Bateson et al., 2002).
Because the PRSV W was recoded
earlier than PRSV P, the type P were considered to be mutated from type W viruses in
nature (Bateson et al., 1994).
However, genomic regions of PRSV responsible for papaya
infection are still not clear.
In current studies, in vitro and in vivo infectious clones of P-YK and W-CI were
constructed to investigate the PRSV genomic determinants responsible for papaya infection.
Nine hybrid viruses were constructed by various recombinations of cDNA fragments of
P-YK and W-CI at the cDNA level and introduced individually into papaya plants for
analysis. The fidelity of all recombinants on horn melon was confirmed by restriction
enzyme digestion after reverse transcription-polymerase chain reaction (RT-PCR).
Results
from infectivity assay on papaya show that gene determining the host specificity of PRSV
type P for papaya infection is located on nucleotides (nts) 6509-7700 region encoding NIa
gene.
4
Materials and methods
Virus sources
Two PRSV, strains P-YK and W-CI examined in this study were collected from
Taiwan. P-YK strain is a PRSV type P virus collected from infected papaya at Yung-kung,
Tainan County (Wang & Yeh, 1997).
W-CI strain is a PRSV type W virus collected from
luffa gourd (Luffa cylindrical Roem) in Chia-yi (Wang et al., 1978).
Their full-length
sequences have been determined previously (GenBank accession numbers NC_001785 and
AY027810 for P-YK and W-CI, respectively).
Both P-YK and W-CI were propagated in
Cucumis metuliferus Naud (Mey. Acc. 2459).
Construction of in vitro infectious clones of PRSV P-YK and W-CI
Virus purification, viral RNA preparation, cDNA synthesis, cloning and nucleotide
sequencing of complete genomic RNA of PRSV P-YK (Wang & Yeh, 1997) or W-CI were
previously described (Yeh et al., 1992).
The strategy for construction of an in vitro
infectious cDNA clone from PRSV P-YK cDNA clones is pressented in Fig. 1.
The RNA
segment including nts 1-621 of viral sequences were amplified by RT-PCR with upstream
primer T3G22 (5'AAGCGCGCAATTAACCCTCACTAAAGAAAAATAAAACATCTCAACACA -3',
containing BssHII site, the T3 promoter and first 22 nucleotide viral sequence) and
downstream primer YKT7602 (5'GAGCGCGCGTAATACGACTCACTATAGGGCCCATCTCAGGCTCCTCAGGTGC
-3', containing BssHII site, T7 promoter, ApaI site, and 602-621 viral sequence).
The
amplified fragment was cloned into Topo pCR2.1 vector (Invitrogen, California, USA) and
confirmed by sequencing. The amplified fragment digested with BssHII was further cloned
into pBluescript II SK(-) (Stratagene, La Jolla, CA), and the resulted plasmid were ligated
5
with other three cDNA clones of P-YK with suitable restriction enzymes to form the full
length infectious clone pT3YKFN1.
The strategy for the construction of in vitro infectious cDNA clone from PRSV W-CI
cDNA is presented in Fig. 2.
The cDNA clone pW312 was first subcloned into
pBluescript II KS(-) to generate p3.1ES by EcoRI/SpeI.
The polylinker sequence of
66-nucleotides located between the T3 promoter and the 5' terminus of PRSV W-CI cDNA
in p3.1ES were removed and the first 17 nucleotidse of 5' terminus of PRSV W-CI were
added by site-directed mutagenesis using GeneEditorTM in vitro Site-Directed Mutagenesis
system (Promega, Madison, WI). The oligonucleotide used for the mutagenesis was
5'-AACCCTCACTAAAGAAAAATAAAACATCTCAACACAACACAATTCAAAGC-3',
which contained 14 nucleotides of the T3 promoter and the first 36 nucleotides of W-CI
viral sequence.
The mutated clone was ligated with other three overlapping cDNA clone
with suitable restriction enzyme sites to obtain the full-length in vitro infectious clone
pT3WCIF1.
Construction of in vivo infectious clones of PRSV P-YK and W-CI
In order to produce viruses conveniently, in vivo infectious clones of PRSV type P and
type W were also constructed.
The plasmid pCaMVCN (Pharmacia/LKB, South Plainfileld,
NJ) containing the Cauliflower mosaic virus 35S promoter and nos terminator was used to
construct in vivo infectious clones.
In construction of in vivo infectious clone of P-YK, the
nt 1-854 of pT3YKFN1 was amplified with the upstream primer PSWCI22
(5'-CCGTCGACAAAAATAAAACATCTCCAACACA-3') and downstream primer
MYK858N (5'-TCGCGGCCGCTTTGAGGAACTGTACTTGT-3') containing a Not I
(underline) site at 5' end.
The amplified fragment was cloned into Topo pCR2.1 vector
(Invitrogen, Califonia, USA) and confirmed by sequencing.
The amplified region was then
cloned into pCaMVCN and the resulted plasmids, pCaMVP5, contained 71 extra nucleotides
6
between the 35S promoter and the 5' end of P-YK sequences.
The 71 nonviral nucleotides
were removed by site-directed mutagenesis (Promega, Madison, WI) with oligonucleotides
P35SPYK20 (5'-GTTCATTTCATTTGGAGAGGAAATAAAACATCTCAACACA-3') which
contained the first 20 nucleotides of P-YK RNA followed by the last 20 nucleotides of the
35S promoter. The mutated plasmid was sequenced to verify the deletion and ligated with
other viral sequence from pT3YKFN1 to obtain the final construct of p35SPYK that
contained a full-length cDNA of P-YK and a 35S promoter and a nos terminator.
The strategy for the construction of in vivo infectious clone of W-CI is similar to the
construction of p35SPYK. The oligonucleotides used for the mutagenesis of W type was
P35SWCI36
(5'-ATTTCATTTGGAGAGGAAAAATAAAACATCTCAACACAACACAATTCAAAGC -3')
to remove the 71 nonviral sequence between the 35S promoter and the first viral sequence.
The final construct of p35SWCI contained a full-length cDNA of W-CI and a 35S promoter
and a nos terminator.
Construction of recombinant viruses
The in vitro or in vivo infectious clones of P-YK and W-CI obtained in this study were
used for construction of different recombinants.
The clones pT3P-WP3CP, pT3P-WCICP,
and pT3P-WNIbCP were constructed by replacing the SphI-NotI, NheI-NotI, and SacI-NotI
fragments of pT3PYKFN1 with the corresponding segments from pT3WCIF1, respectively.
The clones p35SP-WCINIa, p35SP-WCI6k, and p35SP-WNIa were constructed by replacing
the NheI-SacI, NheI-NsiI, and NsiI-SacI fragments of p35SPYK with the corresponding
segments from p35SWCI, respectively. The type W recombinant clone pT3W-PCINIa was
constructed by replacing the NheI-SacI fragments of pT3WCIF1 with the corresponding
segment from pT3PYKFN1.
The other two type W recombinant clones p35SW-PCI6k and
p35SW-PNIa were constructed by replacing the NheI-NsiI and NsiI-SacI of p35SWCI with
the corresponding segment from p35SPYK, respectively.
7
The genomic maps of these
recombinants are presented in Fig 3.
Synthesis of in vitro transcripts and infectivity assay
The procedures to generate in vitro transcripts and mechanical inoculation of host plants
followed the method described previously (Chiang & Yeh, 1997). The in vitro
transcription was carried out with the mCAP mRNA capping kit (Stratagene, La Jolla, CA)
to generate capped transcripts.
The transcription mixture of 40 μl were mechanically
applied with glass spatula onto carborundum-dusted leaves of systemic host papaya (Carica
papaya L) at the 4 true-leaf stage and local lesion host C. quinoa Willd. with eight fully
expanded leaves.
The infectivity assay of in vivo infectious clones were performed by
mechanically introduced 20 μl (total 1μg) DNA plasmid in sterilized water into C. quinoa or
papaya seedlings.
All generated virus were maintained in horn melon (C. metuliferus).
Eight papaya plants at the six-leaf stage or horn melon at the two-leaf stage were inoculated
with the infectious clones for infectivity assay.
The inoculated plants were kept in a
greenhouse (23-28℃) for observation of symptom development.
Confirmation of the construction of hybrid viruses in infected plants
The fidelity of constructed recombinant viruses that showed infectivity on horn melon
was confirmed by RT-PCR and restriction enzyme analysis.
The different restriction
enzymes between cDNA of P-YK and W-CI , contaning the EcoRV, NheI, PstI, and
SphI ,were used for the analysis. Total RNAs were isolated from horn melon leaves
infected with individual recombinant viruses using the procedure of lithium chloride
precipitation (Napoli et al., 1990). The downstream primers MWM2S5014
(5'-ACTATTCGCACCAGTACCGAAATTG-3') and MWM4S8991
(5'-ACTATTCGCACCAGTACCGAAATTG-3') were used for reverse transcription to
synthesize the first strand cDNA. The upstream primer PYK3153
(5'-AAGCCTCATGAACTCCGCAATC-3') and the downstream primer MWM2S5014 were
used to amplify nucleotide positions 3153-5014 and the upstream primer PWM6956
8
(5'-AGGAATTACAATGGCATAGC-3') and the downstream primer MWM4S8991 were
used to amplify nucleotide positions 6956-8891 of the tested viruses by PCR with ExTaq
polymerase (TaKaRa, Shiga, Japan). PCR products were eluted by electrophoreses from
0.8% agarose gel before restriction digestion analysis. According to the different
restriction enzyme sites present in p35SPYK or p35SWCI, the amplified fragments were
digested individually with EcoRV(4335), ShpI(4693), NheI(7147), or PstI (8176).
In order to further confirm the infectivity of the recombinants in papaya infection,
total RNA of examined papaya plants introduced with recombinants 14-21 dpi were
analyzed by amplified the nts 3153-5014 using the primers PYK3153 and MWM2S5014.
Sequence analysis
Two PRSV P type viruses, P-YK and P-HA (GenBank accession number S46722),
and two W type viruses, W-CI and W-TH (GenBank accession number AY010722), were
used for sequence comparisons. The amino acid sequences located from nts 6509 to 7700
of viral sequences were compared by the Pretty program of GCG software (Wisconsin
Package Verssion 10.0, Genetics Computer Group, Madison , Wisc).
9
Results
The infectivity of in vitro and in vivo infectious clones of P-YK and W-CI
Both of in vitro capped transcripts of pT3PYKFN1 and pT3WCIF1 induced local
lesions on C. quinoa leaves but only the transcripts of pT3PYKFN1 infected papaya
seedlings and showed mosaic symptoms on papaya leaves.
The local lesions induced by
capped transcripts of pT3PYKFN1 and pT3WCIF1 were similar to those induced by wild
type P-YK and W-CI except that the development was delayed by 1-2 days.
The progeny
viruses generated from both transcripts of pT3WCIF1 and pT3PYKFN1 are infectious in
horn melon and C. quinoa. Additionally, the virus generated from transcripts of
pT3PYKFN1 also infected papaya. The virus generated from pT3PYKFN1 or pT3WCIF1
had the same host range and induced symptoms similar to those of the wild type P-YK or
W-CI , respectively.
The local lesions induced by p35SPYK and p35SWCI were delayed
for 2-3 days when compared with those induced by the wild type virus.
The viruses
35SPYK and 35SWCI drived from in vivo infectious clones of p35SPYK and p35SWCI
also had the same host range and induced similar symptom to their respective wild type
viruses did.
Confirmation of the construction of recombinant viruses in infected plants
The recombinant viruses P-WP3CP, P-WCICP, P-WNIbCP, and W-PCINIa were
generated from in vitro transcripts of pT3P-WP3CP, pT3P-WCICP, pT3P-WNIbCP, and
pT3W-PCINIa, respectively.
Additionally, the recombinant viruses P-WCINIa, P-WCI6k,
P-WNIa, W-PCI6k, and W-PNIa were generated from in vivo infectious clones of
p35SP-WCINIa, p35SP-WCI6k, p35SP-WNIa, p35SW-PCI6k, and p35SW-PNIa,
respectively. All the recombinants in horn melon were verified by RT-PCR and restriction
enzyme digestion.
Digested patterns all matched well with restriction enzyme maps as
expected (data not shown).
10
Host range assay
All the recombinant viruses were able to infect C. metuliferus and induced mosaic
symptoms 6-8 days post inoculation (dpi).
In papaya, only the plants inoculated with
35SPYK, P-WNIbCP, W-PCINIa, and W-PNIa showed mosaic symptoms 10-14 dpi. The
special wilting symptoms which different from the mosaic type caused by P-YK were
observed on papaya inoculated with P-WCI6k.
The wilting symptoms started from
expanding leaves, leafstalks and stems and 80-90% of the papaya inoculated with P-WCI6k
died by 21st dpi.
Although the papaya plants inoculated with recombinant viruses
W-PCINIa and W-PNIa showed mosaic symptoms, the infected papaya exhibited large
green islands on leaves and recoved 30 dpi.
The other recombinants, containing the
P-WP3CP, P-WCICP, P-WCINIa, P-WNIa, W-PCI6k, and W-CI did not infect papaya even
observations were kept for 60 dpi.
In order to further proof that the P-WP3CP, P-WCICP,
P-WCINIa, P-WNIa, W-PCI6k, and W-CI did not infect the papaya, the RT-PCR was
carried out and no predict fragments were amplified from these symptomless papaya (Fig.
5)
Sequence comparison
Amino acid sequence comparison between P-YK and W-CI showed several
differences located in nts 6509-7700.
Four viruses P-YK, P-HA, W-CI, and W-TH were
analyzed with the Pretty program (Fig. 6).
Between nts 6509-7700 of type P and W
viruses, there are three amino acids are considered critical positions 2269 (V→A), 2309
(K→D), and 2487 (I→V). The amino acid change at positions 2269 and 2309 were
structurally changes more significant than the position 2487.
11
Discussion
The Potyvirus is the largest plant virus genus, but the host ranges of individual
potyvirus are generally narrow.
Investigation of host determination of potyvirus is
important for understanding the host adaptability of the members of Potyvirus.
Here we
use PRSV type P and W to study the host specificity of virus infection in papaya.
Two
viruses P-YK and W-CI collected from the same geographic region share high nucleotide
identity (the lowest 93.24% at P1, the highest 97.08% at HC-Pro), and these two viruses
were constructed to examine the host determinant for papaya infection.
Infectivity assay showed that in vitro and in vivo infectious clones of P-YK and W-CI
were able to produce local lesions on C. quinoa. When the transcripts or in vivo infectious
clones were introduced directly into papaya seedlings, only the transcripts of pT3PYKFN1
and plasmid p35SPYK produced systemic mosaic symptoms.
All the viruses generated
from in vitro or in vivo infectious clones and their respective wild type P and W viruses had
the same host range and induced similar symptoms.
These results indicate all the
infectious clones are suitable for host specificity assay.
In order to identify genes that determine infectivity in papaya, nine recombinants were
constructed. Host range experiments showed that all the viruses with the region nts
6509-7700 of P-YK were able to infect papaya, but all the viruses containing the region nts
6511-7702 of W-CI did not infect papaya plants.
This experiment revealed the region nts
6509-7700 of P-YK is responsible for host specificity for infection in papaya.
Although
the region nts 6509-7700 covers the most of NIa and few amino aicds of the C-terminal
region of NIb protein, there are no differences in the amino acids in the C-terminal regions
of NIb gene between P-YK and W-CI. Our results indicate that the NIa gene of the P-YK
plays a key role in papaya infection.
The amino acid sequences of the NIa genes of W-CI and P-YK share 94.85 % identity.
Sequence analysis revealed that there are only three amino acid differences between type P
12
and type W viruses, and the positions 2269 (V→A) and 2309 (K→D) are critical.
Genomic organization of PRSV indicates that the position 2269 is located in the VPg
domain of NIa and the position 2309 is located in the protease domain of NIa.
Either one
or both of the two amino acids is(are) critical for papaya infection remains to be
investigated.
VPg have been reported involving in viral replication and host genotype specificity.
The VPg of TEV interacts with eukaryotic translation initiation factor eIF4A in a
strain–specific manner (Schaad et al., 2000). This VPg-eIF4E interaction may lead to
inactivation of eIF(iso)4E and results in the shut-off of host protein synthesis. The VPg
proteins of TEV (Schaad et al., 1997), Tobacco vein mottling virus (TVMV) (Nicolas et al.,
1997), Pea seed-borne mosaic virus (PSbMV) (Keller et al., 1998), and Potato virus A
(PVA) (Rajamaki & Valkonen, 1999) were all shown to determine host specificity by
governing systemic movement or replication. The VPg of Potato virus Y (PVY) and
TVMV can overcome the resistance gene va of tobacco (Masulta et al., 1999, Nicolas et al.,
1997), and the VPg of PSbMV determines the pathotype in sbm1/sbm1 homozygous pea
(Borgstrom & Johansen, 2001, Keller et al., 1998).
It is possible that the NIa of PRSV P
interacts specifically with eIF(iso)4E of papaya, but that of type W does not. The intact
protease activity of the NIa gene of PVY is required for inducing the Ry-mediated resistance
response on potato (Mestre et al., 2000).
We do not know whether the protease of PRSV
W is involved in the process of host factors which trigger the host resistant reaction.
Which part of the NIa is the key domain responsible for papaya infection and which host
factor(s) interacts specifically with NIa of PRSV type P or W remains to be answered.
Since P-WCI6K virus caused wilt symptoms on papaya, the CI and 6k gene of virus
may be responsible for pathogenicity. Comparing the wilting symptom induced by
P-WCI6k and those reported by Chang (1979), both caused papaya wilting and fast dying,
but in our case the infected papaya showed yellowing not vein-clear symptoms before
13
wilting.
P.
It needs to investigate whether the CI and 6k related to wilting type of PRSV type
Chu et al. (1997) reported that the P3, CI, 6k, and Vpg genes of TEV are response for
root necrosis that results in wilting symptoms in Tabasco pepper plants.
Our results
indicate that the CI and 6k genes of PRSV are responsible for the wilt symptoms on papaya
plants. However, the wilt symptoms were resulted from top leaves but not by root necrosis.
The CI gene of Turnip mosaic virus (TuMV) have also reported as the pathogenic
determinant to the Brassica ressistance gene TuRB01(Jenner et al., 2000).
It is still not
known how the CI and 6k of W-CI cause the wilting symptoms on papaya and the
mechanism will need further to be studied.
Although the recombinants W-PCINIa or W-PNIa infected papaya and induced
mosaic symptoms, the mosaic papaya plants became recovery 30 dpi.
The results revealed
other viral proteins may be involved in the adaptability of PRSV on papaya.
In summary,
we have shown that the NIa of PRSV is critical for papaya infection and the other viral
proteins may also involve in adaptation on papaya.
14
References
Bateson, M. F., Henderson, J., Chaleeprom, W., Gibbs, A. J. & Dale, J. L. (1994).
Papaya ringspot potyvirus: isolate variability and the origin of PRSV type P
(Australia). Journal of General Virology 75, 3547-53.
Bateson, M. F., Lines, R. E., Revill, P., Chaleeprom, W., Ha, C. V., Gibbs, A. J. & Dale,
J. L. (2002). On the evolution and molecular epidemiology of the potyvirus Papaya
ringspot virus. Journal of General Virology 83, 2575-85.
Borgstrom, B. & Johansen, I. E. (2001). Mutations in Pea seedborne mosaic virus
genome-linked protein VPg alter pathotype-specific virulence in Pisum sativum.
Molecular Plant-Microbe Interactions 14, 707-714.
Chang, C. A. (1979). Isolation and comparison of two isolates of papaya ringspot virus in
Taiwan. Journal of Agricultural Research of China 28, 207-216.
Chiang, C. H. & Yeh, S. D. (1997). Infectivity assays of in vitro and in vivo transcripts of
papaya ringspot potyvirus. Botanical Bulletin of Academia Sinica 38, 153-163.
Chu, M., Lopez-Moya, J., Llave-Correas, C. & Pirone, T. (1997). Two separate regions
in the genome of the tobacco etch virus contain detreminants of the wilting response
of Tabasco pepper. Molecular Plant-Microbe Interactions 10, 472-480.
De La Rosa, M. & Lastra, R. (1983). Purification and partial characterization of Papaya
ringspot virus. Phytopathologische Zeitschrift 106, 329-336.
De Mejia, M. V. G., Hiebert, E. & Prucifull, D. E. (1985). Isolation and partial
characterization of the amorphous cytoplasmic inclusions associated with
infections caused by two potyviruses. Virology 142, 24-33.
Francki, R. I. B., Fauquet, C. M., Knudson, D. L. & Brown, F. (1991). Classification and
Nomenclature of Viruses, pp. (Arch. Virol. Supplementum 2,450pp). Springer, Wien
and New York: Fifth Report of the International Committee on Taxonomy of
Viruses.
15
Gonsalves, D. & Ishii, M. (1980). Purification and serology of Papaya ringspot virus.
Phytopathology 70, 1028-1032.
Jenner, C. E., Sanchez, F., Nettleship, S. B., Foster, G. D., Ponz, F. & Walsh, J. A.
(2000). The cylindrical inclusion gene of Turnip mosaic virus encodes a pathogenic
determinant to the Brassica resistance gene TuRB01. Molecular Plant-Microbe
Interactions 13, 1102-1108.
Keller, K. E., Johansen, I. E., Martin, R. R. & Hampton, R. O. (1998). Potyvirus
genome-linked protein (VPg) determines Pea seed-borne mosaic virus
pathotype-specific virulence in Pisum sativum. Molecular Plant-Microbe
Interactions 11, 124-130.
Martelli, G. P. & Russo, M. (1976). Unusual cytoplasmic inclutions induced by
Watermelon mosaic virus. Virology 72, 352-362.
Masulta, C., Nishimura, M., Morishita, H. & Hataya, T. (1999). A single amino acid
change in viral genome-associated protein of potato virus Y correlates with
resistance breaking in 'Virgin A mutant' tabacco. Phytopathology 89, 118-123.
Mestre, P., Brigneti, G. & Baulcombe, D. C. (2000). An Ry-mediated resistance response
in potato requires the intact active site of the NIa proteinase from Potato virus Y.
Plant Journal 23, 653-661.
Napoli, C., Lemieux, C. & Jorgensen, R. (1990). Introduction of a chimeric chalcone
synthase gene into petunia results in reversible cosuppression of homologous genes
in trans. Plant Cell 2, 279-290.
Nicolas, O., Dunnington, S. W., Gotow, L. F., Pirone, T. P. & Hellmann, G. M. (1997).
Variations in the VPg protein allow a potyvirus to overcome va gene resistance in
tobacco. Virology 27, 452-459.
Provvidenti, R. & Gonsalves, D. (1982). Resistence to papaya ringspot virus in Cucumis
metuliferus and its relationship to resistance to Watermelon mosaic virus 1. Journal
16
of Heredity 73, 239-240.
Purcifull, D. E. & Edwardson, J. R. (1967). Watermelon mosaic virus: Tubular inclusion
in pumpkin leaves and aggregates in leaf extracts. Virology 32, 393-401.
Purcifull, D. E., Edwardson, J. R., Hiebert, E. & Gonsalves, D. (1984). Papaya ringspot
virus. In CMI/AAB Descriptions of Plant Viruses. No 292.
Purcifull, D. E. & Hiebert, E. (1979). Serological distinction of Watermelon mosaic virus
isolates. Phytopathology 69, 112-116.
Rajamaki, M. & Valkonen, J. (1999). The 6K2 protein and the VPg of Potato virus A are
determinants of systemic infection in Nicandra physaloides. Molecular
Plant-Microbe Interactions 12, 1074-1081.
Schaad, M., Anderberg, R. & Carrington, J. (2000). Strain-specific interaction of the
Tobacco etch virus NIa protein with the translation initiation factor eIF4E in the
yeast two-hybrid system. Virology 273, 300-306.
Schaad, M., Jensen, P. & Carrington, J. (1997). Formation of plant RNA virus replication
complexes on membrane: role of an endoplasmic reticulum-targeted viral protein.
EMBO Journal 16, 4049-4059.
Wang, C. H. & Yeh, S. D. (1997). Divergence and conservation of the genomic RNAs of
Taiwan and Hawaii strains of Papaya ringspot potyvirus. Archives of Virology 142,
271-285.
Wang, H. L., Wang, C. C., Chiu, R. J. & Sun, M. H. (1978). A preliminary study of
papaya ringspot virus in Taiwan. Plant Prot. Bull. 20, 133-139.
Webb, R. E. & Scott, H. A. (1965). Isolation and identification of Watermelon mosaic virus
1 and 2. Phtopathology 55, 895-900.
Yeh, S. D. & Gonsalves, D. (1984a). Evaluation of induced mutants of Papaya ringspot
virus for control by cross protection. Phytopathology 74, 1086-1091.
Yeh, S. D. & Gonsalves, D. (1984b). Purification and immunological analysis of
17
cylindrical-inclusion protein induced by Papaya ringspot virus and Watermelon
mosaic virus 1. Phytopathology 74, 1273-1278.
Yeh, S. D. & Gonsalves, D. (1985). Translation of Papaya ringspot virus RNA in vitro:
Detection of a possible polyprotein that is processed for capsid protein,
cylindrical-inclusion protein, and amorphous-inclusion protein. Virology 143,
260-271.
Yeh, S. D., Gonsalves, D. & Provvidenti, R. (1984). Comparative studies on host range
and serology of Papaya ringspot virus and Watermelon mosaic virus 1.
Phytopathology 74, 1081-1085.
Yeh, S. D., Jan, F. J., Chiang, C. H., Doong, T. J., Chen, M. C., Chung, P. H. & Bau, H.
J. (1992). Complete nucleotide sequence and genetic organization of Papaya
ringspot virus RNA. Journal of General Virology 73, 2531-2541.
18
Fig. 1. Construction of in vitro infectious clone of a Yung-kung isolate of P type strain of
Papaya ringspot virus (PRSV P-YK) with a T3 bacterophage promoter. The T3 promoter
was added when the 5' end of P-YK was amplified by RT-PCR.
The final construct was
designated pT3PYKFN1 that contained a complete cDNA copy of P-YK genome.
NotI site was used for linearization the plasmid for in vitro transcription.
19
The
Fig. 2. Construction of in vitro infectious clone of a Chia-yi isolate of W type strain of
Papaya ringspot virus (PRSV W-CI) with a T3 bacteriophage promoter.
The 66 nonviral
sequences located between the transcription initiation site for the T3 promoter and the first
nucleotide of W-CI sequences were removed by site-directed mutagenesis. The final
construct was designated pT3WCIF1 that contained a complete cDNA copy of W-CI
genome.
The NotI site was used for linearization the plasmid for in vitro transcription.
20
3263( Sph I) 4496( Nhe I)
p35SPYK
5'
P1
HC-Pro
P3
CI
pT3P-WP3CP
5'
P1
HC-Pro
P3
pT3P-WCICP
5'
P1
HC-Pro
pT3P-WNIbCP
5'
P1
p35SP-WCINIa
5'
p35SP-WCI6k
7700( Sac I)
Not I
6509( Nsi I)
9500( Apa I)
6K
NIa
NIb
CP
3'
CI
NIa
NIb
CP
3'
P3
CI
NIa
NIb
CP
3'
HC-Pro
P3
CI
NIa
NIb
CP
3'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3'
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3' YW
p35SP-WNIa
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3'
M
pT3W-PCINIa
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
-
M
3' M,R
p35SW-PCI6k
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3'
M
p35SW-PNIa
-
M
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3' M,R
M
p35SWCI
5'
P1
HC-Pro
P3
CI
NIa
NIb
CP
3'
M
M
M
-
M
M
M
-
-
M
M
Fig. 3. The genomic maps of recombinants and the assay of virus infectivity in different
plants. The gray regions represent the cDNA of PRSV P-YK and the blank boxes
represent the cDNA of PRSV W-CI.
M, the virus-infected plant with mosaic symptoms;
YW, the papaya with yellowing and wilting symptoms, R, the symptoms of infected papaya
were recovery, －, no infection.
21
Fig. 4. Symptoms on plants of papaya infected with 35SPYK and 35SWCI and the nine
recombinant viruses at 21 dpi, expect the P-WCI6k at 14 dpi. The viruses of 35SPYK,
P-WNIbCP, , W-PCINIa, and W-PCINIa caused mosaic on papaya, and P-WCI6k cause
yellowing and wilting symptoms.
The other viruses of 35SWCI, P-WP3CP, P-WCICP,
P-WCINIa, W-PCI6k, and P-WNIa did not infect papaya.
22
Fig. 5. The recombinant viruses in infected papaya were detected by RT-PCR.
The total
RNAs of infected papaya were isolated from systemic leaves at 21 dpi, except the P-WCI6k
infected papaya was isolated at 14 dpi. The genomic regions of nts 3153-5014 were
amplified from papaya infected with P-YK, P-WNIbCP, P-WCI6k, W-PCINIa, and W-PNIa
respectively.
The specific fragment of the other recombinant viruses that did not cause
symptoms on papaya were not amplified.
The amplified fragment were indicated by an
arrow.
23
P-HA
P-YK
W-CI
W-TH
CONSENSUS
---------------------------R--------KMHGMGVKTR
------------------------------------KFVATYGFKP
------------------------------------EDYSYVRYLD
------------------N
------------------PLTGETLDES
---------D
---------------------------PQTDISMVQE
--S---R-----------------------------HFGDIRNKYM
D-------A--------S--------SG-------AESDSFDRQ*L
----T-------------------------------IANNVIKAYY
------A-----------I-----------------VRNSAKTALE
------------------------------------VDLTPHNPLK
100
100
100
100
P-HA
P-YK
W-CI
W-TH
CONSENSUS
---N--------------------------------VCDTKLTIAG
------------------------------------FPDREAELRQ
----R--QV----K---V----K---A----R---ATGPP*TIL*D
-----S------------------------------QVPPPTKSVH
VPg of NIa
---------- ------------------- ------------------- ------------------- ---------HEGKSLCQGM RNYNGIASVV
Pro of NIa
--------K--------K--------D--------DCHLKNTSG*G
K----I------------------------------RSLFGVGYNS
------------------------------------FIITNRHLFK
------------------------------------ENNGELIVKS
200
200
200
200
P-HA
P-YK
W-CI
W-TH
CONSENSUS
-----I------------------------------QHGKFVVKNT
---QI--------L----A---L----S---I--I-TTLR*APVGK
---------------------------N
---------TDLLIIRMPK
---------------------------K
----S----DFPPFHSRAR
-----------------------------T------FRAMKAGDKV
------------------------------------CMIGVDYQEN
------------------------------------HIASKVSETS
-------D------M---------------------IISEGTGEFG
---------S--------------------------CHWISTNDGD
------------------------------------CGNPLVSVSD
300
300
300
300
P-HA
P-YK
W-CI
W-TH
CONSENSUS
-F--------Y--------Y--------F-------G*IVGLHSLS
------------------------------------TSTGDQNFFA
----Q-------------------------------KIPAFFEEKV
--K---------------------------------LRRIDDLTWS
------I--------I--------V--------V--KHWSYN*NEL
------------------------------------SWGALKVWES
------------------------------------RPEAIFNAQK
-V---------------------------D------EINQLNVFEQ
--G---------------------------------SGSRWLFDKL
NIb
----------------------------HGNLKGVS
398
398
398
398
Fig. 6. The amino acid sequence comparison of the genomic regions of nts 6509-7700 of
P-YK, P-HA, W-CI, and W-TH. Three amino acids in positions 2263 (V→A),
2309(K→D), and 2487 (I→V) were found differently in the region between two type P and
two type W viruses. The changes at the positions 2269 (V→A) and 2309 (K→D) are
structurally significant.
Arrows indicate the cleavage sites of viral proteins and boxes
indicates the positions of the three different amino acids.
24