Examination in Gene Technology, TFKE38 2012-10-20
1) Explain briefly the following concepts in molecular biology
a) Inclusion body
b) Tm-value
c) Blue-white screening
d) Plaques
e) Cosmids
(10 p)
2) In gene cloning two types of vectors, plasmids and phages are often used.
a) Give some characteristics for these two types of vectors.
(2p)
b) How do you select for recombinants in these types of vectors?
(2p)
c) The procedure for purification of plasmids and phages are different, describe the
methods for purification of plasmids and phages, respectively.
(6p)
3) The enzymes alkaline phosphatase, terminal deoxynucleotide transferase and
polynucleotide kinase are three modifying enzymes often used in gene cloning
experiments.
a) Describe the function of these enzymes and their application in molecular biology.
(6p)
b) Ligation is often a critical step in gene cloning experiments. Give two examples of
how you can improve the efficiency of the ligation reaction.
(4p)
4) As a newly recruited molecular biologist for a Biotech company you will clone an
important human protein for therapeutic purposes starting from a cDNA library to find
and isolate the gene.
a) Describe the principles of the different steps to create a cDNA library
(2p)
b) To analyze the results of the created cDNA library you run an agarose gel (Figure
1) from randomly selected clones. What conclusions can be drawn about the
cDNA library from the agarose gel?
(2p)
Figure 1 Agarose gel electrophoresis of purified plasmids from randomly selected clones from a cDNA
libray (Lane 5, 10 and 19 are molecular weight marker)
c) Below is the DNA sequence of a human therapeutic protein you want to clone
(Figure 2). Design primers for amplification of this gene from the cDNA library.
(4p)
5’-ATGGGGGTGCACGAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGCTCCCT
CTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCCTGGAG
AGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGACGGGCTGTGCTGAACACTGC
AGCTTGAATGAGAATATCACTGTCCCAGACACCAAAGTTAATTTCTATGCCTGGAAGAGG
ATGGAGGTCGGGCAGCAGGCCGTAGAAGTCTGGCAGGGCCTGGCCCTGCTGTCGGAAGCT
GTCCTGCGGGGCCAGGCCCTGTTGGTCAACTCTTCCCAGCCGTGGGAGCCCCTGCAGCTG
CATGTGGATAAAGCCGTCAGTGGCCTTCGCAGCCTCACCACTCTGCTTCGGGCTCTGCGA
GCCCAGAAGGAAGCCATCTCCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATC
ACTGCTGACACTTTCCGCAAACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTG
AAGCTGTACACAGGGGAGGCCTGCAGGACAGGGGACCTTTGA-3’
Figure 2. DNA sequence of the human therapeutic protein
d) In order to ligate the gene into a vector you want to create restriction sites that
cause a silent mutation in the 3’-end of the gene (Figure 2 underlined sequence).
What is meant be a silent mutation?
(2p)
e) Design a palindromic sequence causing a silent mutation in the underlined
sequence (figure 2) (Help: Table of the Genetic code in Appendix)
(4p)
f) In order to obtain high yield of the expressed protein you use an inducible
promoter. What is the advantage of using such a type of promoter?
(2p)
g) A reason for low yield of expressed protein is codon usage bias. What is meant by
this term and describe a method how this can be avoided.
(4p)
Appendix
Genetic code