SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
SUPPLEMENTARY DATA
Methods
Gene Expression Analysis:
LOVO and two clones of LOVOCDX2-/- cells were grown over-agar (anchorage-independent
conditions)(Dang et al., 2006).
Cells were harvested and total RNA extracted. Gene
expression analyses on the samples were performed at the University of Michigan
Comprehensive Cancer Center Affymetrix Core Facility. To control for clonal variation, two
clones of LOVOCDX2-/- were compared to LOVO cells and to each other. Commercial highdensity oligonucleotide arrays (GeneChip Human Genome U133A; Affymetrix, Inc.) were used,
following protocols and methods developed by the supplier. The human genome U133A chip
consists of 22,283 probe sets of 25-base long single-stranded DNA sequences, each
representing a transcript. Single stranded cDNA were synthesized and converted into double
stranded cDNA. An in vitro transcription (IVT) reaction was then carried out in the presence of
biotinylated UTP and CTP to produce biotin-labeled cRNA. cRNA were then fragmented and
hybridized to the test array, washed and stained with streptavidin-phycoerythrin, then scanned
using GeneArray scanner. Images were analyzed following quality control parameters provided
by Affymetrix. Once the data obtained from the test array is satisfactory, the samples were
hybridized to the standard array for 16 hours at 45 oC, washed and stained using the fluidics
station, then scanned. The images were analyzed using Microarray Suite Software and
comparison analyses were carried out according to the instructions provided by Affymetrix.
The first step in data analysis was to assure overall quality of the raw data. For each sample,
the distribution of the perfect match (PM) probes were graphed (log intensity as a function of
1
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
density), and RNA degradation plot was generated (Probe Number as a function of Mean
Intensity:shifted and scaled) (Chaib et al., 2003; Ray et al., 2004) . The shapes and slopes of
all curves appeared similar, so the raw data were of high quality. The expression values for all
the genes on each chip were computed using a robust multi-array average (RMA) and genes
that appear not to be expressed were filtered out (Chaib et al., 2003; Ray et al., 2004).
Comparisons were then made using a 2-fold cutoff. Data in the form of expression values and
fold change were output into HTML files. Microsoft Excel data spreadsheets were generated
for data analysis.
Real time RT-PCR
LOVO and two clones of LOVOCDX2-/- cells were grown over-agar, RNA was extracted, reverse
transcribed, and subjected to real time RT-PCR using primers for IGFBP-3 Forward 5’ctctgcgtcaacgctagtgc-3’ and Reverse 5’-cggtcttcctccgactcact-3’ (Dang et al., 2006).
Western Blot Analyses
LOVO and two clones of LOVOCDX2-/- cells were grown over-agar and whole cell lysates
extracted for western blot as previously described (Dang et al., 2006). CDX2 is a 37 kD band,
IGFBP-3 is a 41-44 kilodaltons (kD) doublet, -tubulin, a control for loading, is a 43 kD band.
CDX2 antibody was purchased from Biogenex (San Ramon, CA), IGFBP-3 antibody from R &
D Systems (Minneapolis, MN), and -tubulin antibody from Sigma (St. Louis, MO). Antibody
dilutions were as recommended by the manufacturers.
ELISA for IGFBP3
LOVO and two clones of LOVOCDX2-/- cells were grown in serum-free media over 48 hours and
conditioned media harvested as previously described (Kansra et al., 2000). The media was
subjected to IGFBP-3 ELISA per manufacturer directions (R & D Systems).
2
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
Sequencing
The IGFBP-3 gene in LOVO cells was sequenced as previously described (Dang et al., 2006),
using previously described primers (Zou et al., 1998).
CHIP Assays
Cells were grown over-agar and subjected to CHIP assays (Active Motif, Carlsbad, CA)
(Solomon et al., 1988). Chromatin was isolated, sheared, and immunoprecipitated with antiCDX2 or anti-RNAPII antibody.
Input chromatin was similarly treated, but not
immunoprecipitated. All chromatins were then reverse cross-linked and the eluted genomic
DNA subjected to PCR with primers flanking the regions of interest. All primers are detailed in
Supplementary Data, Table 1.
CDX2 antibody was purchased from Biogenex,
RNAPII
antibody from Active Motif.
Dual-Luciferase Assays
Four fragments of the IGFBP-3 promoter were PCR amplified and linked to the pGL3Firefly luciferase reporter (Promega, Madison, Wisconsin). The –732 construct contains the
putative CDX2 binding region D, which includes 3 putative CDX2 binding sites: site 1 at –694
(TTAAA), site 2 at –676 (GTAAATTAAA), and site 3 at –593 (ATAAA). These putative sites
are denoted as diamonds on figure 2A of the manuscript. The –680 construct contains only
sites 2 and 3, the –605 construct contains site 3 alone, and the –560 construct does not
contain any of the sites.
The –732 IGFBP-3-pGL3 construct was also subjected to site-
directed mutagenesis of site 1(-7321), site 2 (7322), or both sites 1 and 2 (73212). For
site-directed mutagenesis, Site 1 was changed from ATAAA to AGCGC; and site 2 was
changed from GTAAATTAAA to GGCGCTGCGC, using the Quickchange site-directed
mutagenesis kit (Stratagene, La Jolla, CA). The pGL3-Firefly luciferase constructs were co-
3
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
transfected with a CMV-Renilla construct into cells using Lipofectamine as previously
described (Dang et al., 2001). Luciferase activity was measured using the Dual-Luciferase
Reporter Assay System (Promega). These studies were performed on cells grown on plates at
post-confluence, rather than over-agar. We were unable to recover viable cells under overagar growth conditions after transient transfections. We suspect that the over-agar condition is
too severe for newly transfected cells to grow in. Thus, transient transfections were performed
on cells grown on plates at post-confluence. This approach is based on observations that
under post-confluent culture conditions, CDX2 expression increases (Boulanger et al., 2005;
Qualtrough et al., 2002), and is associated with increased proliferation (Suh & Traber, 1996)
and decreased IGFBP-3 expression (figure S1, supplementary data).
Colony formation of cells treated with IGFBP-3 and IGF-1 analogues
Cells were grown in soft agar and treated with recombinant human IGFBP-3 (rh
IGFBP-3 at 100 ng/ml), IGFBP-3 monoclonal antibody (mAb IGFBP-3 at 5 ug/ml),
insulin-like growth factor 1 (IGF-1 at 50 ng/ml), and Long insulin-like growth factor 1
(LIGF-1 at 50 ng/ml). rh IGFBP-3 and mAb IGFBP-3 were from R & D Systems and
IGF-1 and LIGF-1 were from GroPrep (Adelaide, Australia). The doses used were as
previously published (Chan et al., 2005; Francis et al., 1992; Haluska et al., 2006;
Kirman et al., 2004; Martin et al., 2003; Ricort & Binoux, 2004).
Photographs were
taken of 5 different areas from each triplicate plate. Image Pro Plus software was used
to determine the plate density, which is the percent of the photographed area taken up
by colonies, as previously described (Dang et al., 2006).
4
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
Table 1: Primers used for CHIP Assays in Figure 2
Primer
Name
Genomic Locus
Forward
Region A -2011 to –1784 from
initiation of IGFBP-3
promoter (227 bp).1
5’-gccgaacccagctctaattt-3’
Region B -1723 to -1474 of IGFBP3 promoter (249 bp). 1
5’-actccacccccacaaactct-3’
Region C -1041 to -808 of IGFBP-3
promoter (233 bp). 1
5’-tacgaagtcgccttcaaaaa-3’
Region D -705 to –555 of IGFBP-3
promoter (150 bp). 1
5’-cccctggggatataaacagc-3’
MUC2+
-238 to –91 of MUC2
promoter (includes CDX2
binding site) (147 bp). 2
5’-tgttggcattcaggctacag-3’
MUC2-937 to –790 of MUC2
promoter
(Non-CDX2
binding site) (147 bp). 2
5’-ctcgtagtctgggtcggtgt-3’
GAPDH+ RNA
polymerase
II
binding site on the
GAPDH promoter (166
bp). 3
5’-tactagcggttttacgggcg-3’
1 Figure 2A.
2 (Gum et al., 1997).
3 Active Motif, Carlsbad, CA.
5
Reverse
5’-caggctgtggctacactcaa
5’-ctgtattctcgatgcgttgg
5’-attaagagtggaccggcaag-3’
5’-gcattcgtgtgtacctcgtg-3’
5’-tgccagatgatcaagaagaca-3’
5’-aggtctccccagaactacctc-3’
5’tcgaacaggaggagcagagagcga3’
mRNA relative to GAPDH
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
30
Pre-confluent
25
Post-confluent
20
Over-agar
15
10
5
0
CDX2 BP3
Cell lines:
Figure S1:
LOVO
CDX2 BP3
CDX2 BP3
CDX2 BP3
SW48
LS174T
LOVOCDX2-/-
CDX2 and IGFBP-3 expression under pre-confluent, post-
confluent, and anchorage-independent conditions. Cells were grown under
anchorage-dependent
(pre-confluent
and
post-confluent) and
anchorage-
independent conditions. CDX2 and IGFBP-3 expression were measured by real
time RT-PCR. Consistent with the literature, CDX2 expression was modestly
increased in post-confluent compared to pre-confluent cells (Boulanger et al.,
2005; Qualtrough et al., 2002); and further increased in anchorage-independent
cells. This increase in CDX2 was associated with decreased IGFBP-3 (BP3)
expression. Thus, CDX2 and IGFBP-3 expression are inversely correlated in the
examined subset of colorectal cancer cell lines.
Furthermore, when CDX2 was
disrupted (LOVOCDX2-/-), IGFBP-3 expression was not only increased ~2-3-fold,
but also failed to be down-regulated as cells were grown in post-confluent and
anchorage-independent conditions. Taken together, these data would suggest
6
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
that as colorectal cancer cells are challenged under post-confluent or anchorageindependent growth conditions, CDX2 is up-regulated and corresponds to downregulation of IGFBP-3.
This notion is supported by previous reports that
associated CDX2 induction and enhanced proliferation in post-confluent intestinal
epithelial cells (Boulanger et al., 2005; Qualtrough et al., 2002; Suh & Traber,
1996).
Based on these data showing an inverse relationship between CDX2
and IGFBP-3 under post-confluent conditions, and our inability to grow transiently
transfected cells over-agar, the dual-luciferase reporter assays in Figure 3 were
performed on post-confluent cells.
Pre-confluent cells were seeded on plates
and grown until 50% confluence. Post-confluent cells were seeded on plates and
grown until one day post-confluence. Over-agar cells were grown in liquid media
over-agar as previously described (Dang et al., 2006). Primers for CDX2 were
Forward 5’-aaggacgtgagcatgtaccc-3’ and Reverse 5’-gtggtaaccgccgtagtcc-3’.
Primers for IGFBP-3 were Forward 5’-ctctgcgtcaacgctagtgc-3’ and Reverse 5’cggtcttcctccgactcact-3’.
7
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
Supplementary Data References:
Boulanger, J, Vezina, A, Mongrain, S, Boudreau, F, Perreault, N, Auclair, BA et
al. (2005). Cdk2-dependent phosphorylation of homeobox transcription
factor CDX2 regulates its nuclear translocation and proteasome-mediated
degradation in human intestinal epithelial cells. J Biol Chem 280: 18095107.
Chaib, H, MacDonald, JW, Vessella, RL, Washburn, JG, Quinn, JE, Odman, A et
al. (2003). Haploinsufficiency and reduced expression of genes localized
to the 8p chromosomal region in human prostate tumors. Genes
Chromosomes Cancer 37: 306-13.
Chan, SS, Twigg, SM, Firth, SM,Baxter, RC. (2005). Insulin-like growth factor
binding protein-3 leads to insulin resistance in adipocytes. J Clin
Endocrinol Metab 90: 6588-95.
Dang, DT, Mahatan, CS, Dang, LH, Agboola, IA,Yang, VW. (2001). Expression
of the gut-enriched Kruppel-like factor (Kruppel-like factor 4) gene in the
human colon cancer cell line RKO is dependent on CDX2. Oncogene 20:
4884-90.
Dang, LH, Chen, F, Ying, C, Chun, SY, Knock, SA, Appelman, HD et al. (2006).
CDX2 has tumorigenic potential in the human colon cancer cell lines
LOVO and SW48. Oncogene 25: 2264-72.
Francis, GL, Ross, M, Ballard, FJ, Milner, SJ, Senn, C, McNeil, KA et al. (1992).
Novel recombinant fusion protein analogues of insulin-like growth factor
(IGF)-I indicate the relative importance of IGF-binding protein and receptor
binding for enhanced biological potency. J Mol Endocrinol 8: 213-23.
Gum, JR, Hicks, JW,Kim, YS. (1997). Identification and characterization of the
MUC2 (human intestinal mucin) gene 5'-flanking region: promoter activity
in cultured cells. Biochem J 325 ( Pt 1): 259-67.
Haluska, P, Carboni, JM, Loegering, DA, Lee, FY, Wittman, M, Saulnier, MG et
al. (2006). In vitro and in vivo antitumor effects of the dual insulin-like
growth factor-I/insulin receptor inhibitor, BMS-554417. Cancer Res 66:
362-71.
Kansra, S, Ewton, DZ, Wang, J,Friedman, E. (2000). IGFBP-3 mediates TGF
beta 1 proliferative response in colon cancer cells. Int J Cancer 87: 373-8.
Kirman, I, Poltoratskaia, N, Sylla, P,Whelan, RL. (2004). Insulin-like growth
factor-binding protein 3 inhibits growth of experimental colocarcinoma.
Surgery 136: 205-9.
Martin, JL, Weenink, SM,Baxter, RC. (2003). Insulin-like growth factor-binding
protein-3 potentiates epidermal growth factor action in MCF-10A
mammary epithelial cells. Involvement of p44/42 and p38 mitogenactivated protein kinases. J Biol Chem 278: 2969-76.
Qualtrough, D, Hinoi, T, Fearon, E,Paraskeva, C. (2002). Expression of CDX2 in
normal and neoplastic human colon tissue and during differentiation of an
in vitro model system. Gut 51: 184-90.
8
SY Chun et al
CDX2 transcriptionally represses IGFBP-3, Supplementary Data
Ray, ME, Yang, ZQ, Albertson, D, Kleer, CG, Washburn, JG, Macoska, JA et al.
(2004). Genomic and expression analysis of the 8p11-12 amplicon in
human breast cancer cell lines. Cancer Res 64: 40-7.
Ricort, JM,Binoux, M. (2004). Insulin-like growth factor binding protein-3
stimulates phosphatidylinositol 3-kinase in MCF-7 breast carcinoma cells.
Biochem Biophys Res Commun 314: 1044-9.
Solomon, MJ, Larsen, PL,Varshavsky, A. (1988). Mapping protein-DNA
interactions in vivo with formaldehyde: evidence that histone H4 is
retained on a highly transcribed gene. Cell 53: 937-47.
Suh, E,Traber, PG. (1996). An intestine-specific homeobox gene regulates
proliferation and differentiation. Mol Cell Biol 16: 619-25.
Zou, T, Fleisher, AS, Kong, D, Yin, J, Souza, RF, Wang, S et al. (1998).
Sequence alterations of insulin-like growth factor binding protein 3 in
neoplastic and normal gastrointestinal tissues. Cancer Res 58: 4802-4.
9