BioSc 231
General Genetics
Exam 5
Name __________________________________
Multiple Choice. (2 points each)
__C__ When an organism gains or loses one of more chromosomes but not a complete haploid set, the conditions is known as
A. polyploidy
B. euploidy
C. aneuploidy
D. triploidy
E. trisomy
__D__ It was once thought that the ____ karyotype was related to criminal disposition because it led to aggressive behavior due to
excessive "maleness".
A. XO
B. XY
C. XXY
D. XYY
E. YY
__D__ Differing sizes of restriction fragments produced from the alleles of a gene constitute
A. a southern blot
B. an allozyme
C. identification of a gene
D. a restriction fragment length polymorphism
__B__ Which of the following is NOT necessary in order for a population to maintain Hardy-Weinberg equilibrium?
A. random mating
B. high rate of migration
C. large population size
D. allele frequencies are the same in males and females
__B__ In a population in Hardy-Weinberg equilibrium the frequency of the allele for Hartnup disease is 0.008. What percentage of
the population is homozygous for this allele?
A. 0.064%
B. 0.0064%
C. 0.008%
D. 99%
E. 0.01%
__E__ In a population with two alleles, B and b, the frequency of b is 0.56. What would be the frequency of the heterozygotes,
assuming Hardy-Weinberg equilibrium?
A. 0.55
B. 0.36
C. 0.71
D. 0.31
E. 0.49
__B__ Which of the following processes does not contribute to changing allele frequencies in populations?
A. mutation
B. inbreeding
C. migration
D. natural selection
E. genetic drift
__C__ Enzyme that cleaves DNA at sequence-specific sites is called
A. DNA polymerase
B. ligase
C. restriction endonuclease
D. sticky ends
E. cDNA
__C__ DNA termini without overhangs produced by endonuclease digestion are called
A. cohesive termini
B. sticky ends
C. blunt ends
D. oligonucleotides
E. none of the above
__C__ Which enzyme functions to synthesize RNA from a DNA template?
A. DNA polymerase
B. RNA polymerase
C. reverse transcriptase
D. ligase
E. endonuclease
__C__ Which vector element below can accept the largest DNA fragment in cloning experiments?
A. plasmid
B. bacteriophage lambda
C. YAC
D. cosmid
__A__ To prepare clones representing expressed genes from a eukaryotic cell, you would mix total cellular mRNA with
A. reverse transcriptase
B. RNA polymerase
C. DNA polymerase
D. integrase
E. RNAse
__D__ Polyploid plants found in nature usually have even numbers of chromosomes because organisms having odd numbers
A. exhibit altered mitosis
B. are unable to asexually reproduce
C. exhibit altered growth
D. have low fertility
E. are not viable
__E__ Pollen from one species germinates on the stigma of another related species and sexually fertilizes the ovule. Most of the
resulting plants are sterile but some of the resulting offspring undergo chromosome duplication resulting fertile plants. The
fertile offspring are known as
A. hexaploid
B. autopolyploid
C. monoploid
D. diploid
E. allopolyploid
__C__ In a mammal how many inactivated X chromosomes (Barr bodies) would be present in cells of individuals who were XXX?
A. 0
B. 1
C. 2
D. 3
E. 4
__E__ When an allotetraploid is backcrossed to one of its progenitor species, a sterile progeny is produced. The genomic composition
of this sterile individual can be best represented by
A. n1 + n2
B. 2n1 + 2n2
C. 2n1
D. 2n2
E. 2n1 + n2
__C__ Euploidy is
A. a chromosome number that is not an exact multiple of the haploid number
B. an example of aneuploidy
C. a chromosome number that is an exact multiple of the haploid number
D. the addition of an extra copy of a particular chromosome
E. the absence of a particular copy of a chromosome
__E__ Calico cats have a patchwork pattern of yellow and black spots. This pattern is an example of
A. somatic mutation
B. dosage compensation
C. mitotic segregation
D. all heterozygotes display this phenomenon regardless of sex
E. mosaicism
__D__ The basic diploid chromosome number in Poinsettia is 16. A new species of Poinsettia is found that has four complete sets of
the chromosomes found in the 16 chromosome species. This species is said to be
A. haploid
B. diploid
C. triploid
D. tetraploid
E. pentaploid
__C__ Consider a species with a diploid (2n) number of 10 chromosomes. How many chromosomes would be found in a trisomic
body cell?
A. 9
B. 10
C. 11
D. 20
E. 21
__A__ Consider a species with a diploid (2n) number of 20 chromosomes. How many chromosomes would be found in a monoploid
body cell?
A. 10
B. 20
C. 21
D. 19
E. 40
__A__ How many different trisomics could be formed in a plant with a diploid number of 20?
A. 10
B. 20
C. 21
D. 19
E. 40
__A__ Mosaicism is due to
A. X-inactivation
B. chromosome duplication
C. chromosome deletion
D. somatic mutations
E. gametic mutations
__E__ A collection of plasmids containing foreign DNA fragments representing the entire genome of an organism is called a(n)
A. transgenic
B. cDNA
C. clone
D. vector
E. library
Problems (3 points each)
You want to design an oligonucleotide probe to identify a clone containing a new enzyme that you purified. You determine that the
amino terminal sequence of your enzyme is:
MCFYMDW
What should be the sequence of the oligonucleotide probe? Indicate redundancy by putting all possible nucleotides for a particular
position in parenthesis.
ATGTG(TC)TT(TC)TA(TC)ATGGA(TC)TGG
In a restriction mapping experiment using the plasmid PST, you cleave the circular plasmid with the individual restriction enzymes
XbaI, Asp718, BamHI, and EcoRI individually and in combination with one another and obtain restriction products of teh sizes
shown below:
Enzyme(s) used
Sizes of DNA fragments produced (bp)
BamHI, EcoRI, XbaI
3,000, 1,550
Asp718, BamHI, XbaI
3,000, 2,500, 600
Asp718, BamHI
5,500, 600
Asp718, XbaI
3,600, 2,500
BamHI, XbaI
3,100, 3,000
Asp718
6,100
BamHI
6,100
XbaI
6,100
Using the above data, make a restriction map of the PST plasmid indicating distances between adjacent restriction sites.
Bertie is married to Matilda, who was previously married to Wynton, now deceased. Wynton and Matilda conceived one child
together and adopted one child. Bertie and Matilda have also conceived one child. All members of Matilda's current family have had
DNA fingerprinting done at a single VNTR locus. Unfortunately, the sheet that identified each child has been misplace. Identify
which fingerpring in each lane (in lanes 5, 6, and 7) correspond to each child.
Bertie’s and Matilda's conceived child
Child __3__
Wynton and Matilda's conceived child
Child __2__
Wynton and Matilda's adopted child
Child __1__
To the right is a hypothetical autoradiogram of a dideoxy sequencing gel. What is the sequence of the gene fragment? Be sure to
label the 5' and 3' ends.
5’ - CTCTAGAGGATCCCCACGTCAGTATACCTG - 3’