“FOR REFEREES ONLY” “FOR REFEREES ONLY” “FOR REFEREES ONLY”
MATERIALS AND METHODS
Patients.
The samples consisted of BM aspirates obtained from 60 patients (mean age, 68 years; range, 55-87 years), newly diagnosed as having active symptomatic MM 3 requiring therapy in accordance with
International Myeloma Working Group (IMWG) criteria,
2,3
and classified according to ISS.
4
Fortythree of such patients showed radiological evidence of bone involvement, which included osteolysis, osteoporosis, pathological fractures, spinal cord compression and plasmacytoma. In all the patients, radiological skeletal bone survey including spine, pelvis, skull, humeri, and femurs was used to detect the presence of bone lesions. Further, some of them deserved magnetic resonance imaging (MRI) or computerized tomography (CT) to assess symptomatic bony sites with negative skeletal survey, suspected cord compression or size of tumor mass. The controls included BM aspirates from 38 subjects with monoclonal gammopathy of uncertain significance (MGUS) without bone disease, matched for age and sex with the patients diagnosed as having symptomatic MM. BM aspirates were obtained from the iliac crest after informed consent was given, according to the tenets of the Declaration of Helsinki. Approval was obtained from the Institutional Review Board of the Department of Internal Medicine and Public Medicine of University of Bari.
Cells
Human myeloma cell lines ( HMCLs) and CD138+ cells.
HMCLs, such as H929, RPMI 8226, U266 and Karpas 929, were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum
(FBS; Gibco Invitrogen, Milan, Italy). Malignant plasma cells from BM aspirates of symptomatic
MM patients with bone disease, or from patients without bone disease were identified as CD138+ cells; whereas CD138+ cells isolated from BM aspirate of MGUS were utilized as negative controls. CD138+ cells were carried out with a magnetic cell sorting (MACS) separator (Miltenyi

Biotec, Bergisch-Gladbach, Germany) using magnetic microbeads (Miltenyi Biotec) coupled to anti-CD138 monoclonal antibody (mAb). Only samples with a purity of more than 97%, checked by flow cytometry, were considered. Fresh CD138+ cells were immediately analyzed, and lysed for real time PCR or western blot analysis after purification or co-cultured with human BMSCs from
MGUS controls.
Human bone marrow cells. BM aspirates of MGUS controls were subjected to Histopaque 1077 density gradient (Sigma, St Louis, MO). The buffy coat cell fraction was entirely cultured to obtain the BM mononuclear cells (BMNCs) utilized in colony forming unit fibroblast (CFU-F) and colony forming unit osteoblast (CFU-OB) assays. BM stromal cells (BMSCs) were obtained from adherent fraction of BMNCs and utilized in co-culture experiments.
Peripheral blood B lymphocytes. B cell selection from peripheral blood mononuclear cells of normal donors was carried out with a B cell negative isolation kit (Dynal, Lake Success, NY, USA), that isolates untouched human B cells by depleting T cells, NK cells, monocytes, macrophages, dendritic cells, granulocytes, platelets and erythrocytes from buffy coat. These cells were cocultured with human BMSCs from MGUS controls, and utilized as negative control of myeloma cells from patients with bone disease.
Cell culture condition and co-cultures.
Human BMNCs were plated at the density of 4X10
5
/cm
2
in an OB differentiating medium, consisting of

-MEM supplemented with 10% FBS, 50 µg/mL ascorbic acid (Sigma Aldrich), and
10
-8
M dexamethasone (Sigma Aldrich). These cells were co-cultured with 1X10
5
/cm
2
HMCLs or
CD138+ cells from symptomatic MM patients, or purified B lymphocytes from normal donors. All experiments of co-culture were performed in the presence or absence of neutralizing anti-sclerostin monoclonal antibody (mAb) (R&D Systems, Minneapolis, MN) at the concentration of 50 and 500 ng/ml or anti-immunoglobulin G (IgG) control Ab. The antibodies were also added to BMSCs

cultured alone to exclude any toxic effect. Long-term co-cultures were performed in OB differentiating medium for 21 days to induce BMSC differentiation toward osteoblastic phenotype, and evaluate the formation of CFU-F. We also performed some co-cultures maintained in osteogenic medium, consisting of osteoblast differentiating medium supplemented with 10 mM beta-glycerophosphate (Sigma Aldrich), for 30 days to induce a more differentiated osteoblastic phenotype and evaluate the formation of CFU-OB. Moreover, we also performed short-term cocultures between semiconfluent BMSCs and HMCLs or myeloma cells or B lymphocytes maintained for 48 hours with osteoblast differentiating medium, to analyze protein expression of
COLL I, RANKL, OPG, Runx2, Osterix, Fra1, Fra2, JunD,

-catenin and Sclerostin-LRP-5 or
Sclerostin-LRP-6 complex. In parallel, we performed long-term co-cultures for 30 days with osteogenic medium to analyze protein expression of BSP II and mRNA expression of Osteocalcin.
In these experiments HMCLs or myeloma cells were removed using a negative immunoselection with anti-CD138 mAb (magnetic activated cell sorting [MACS] and B lymphocytes were removed using a positive immunoselection with anti-CD19 mAb (Dynal, Lake Success). BMSCs were subjected to RNA or protein extraction to perform real time-PCR or western blot analysis.
CFU-F and CFU-OB assays.
For CFU-F evaluation after 21 day incubation the cells were fixed with 25% of citrate solution,
65% of acetone and 8% of formalin, for 30 seconds and stained with alkaline phosphatase histochemical kit (Sigma Aldrich) according to the manufacturer's procedures. Each colony was defined by the presence of at least 50 alkaline phosphatase-positive cells and quantified by direct counting of all positively stained colonies. For CFU-OB evaluation, cells were fixed with 3% paraformaldeide for 10 minutes, washed 3 times with PBS, and stained for Von Kossa staining.
33
Von Kossa staining identifies osteoblast-differentiated cells able to produce mineralized nodules.
Colonies were quantified by direct counting of all stained bone nodules positive for Von Kossa under light microscopy. Images were visualized under a Nikon Eclipse E 400 microscope.

Cell viability assay.
Cell viability was measured by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) assay. Briefly, BMSCs were cultured in 96-well tissue-culture plates in the presence or absence of HMCLs for 48 h or 30 days to evaluate cell viability. MTT (Sigma Aldrich) 0.5 mg/ml were added to the culture media, followed by 4 hours incubation at 37 o
C in a humidified 5% CO
2 atmosphere. The reaction was stopped by the addition of 150
 l of 0.04 N HCl in absolute isopropanol. The optical density was read at 570 nm using an automatic plate reader (555
Microplate Reader Bio-Rad Laboratories Inc. USA).
RNA isolation and Real-Time-polymerase chain reaction (Real Time-PCR) amplification.
Total cellular RNA was extracted using spin columns (Rneasy; Quiagen, Hilden, Germany). RNA
(1 µg) was reverse-transcribed according to the manufacture’s procedures, using the Super Script
First-Stand Synthesis System kit for RT-PCR (Invitrogen, Carlsbard, CA, USA). cDNA was amplified with the iTaq SYBR Green supermix with ROX kit (Bio-Rad Laboratories, Bio-Rad
Laboratories Inc., CA, USA), and the PCR amplification was performed using the Chromo4 Real-
Time PCR Detection System (Bio-Rad Laboratories). The following primer pairs were used for the
PCR amplification: Sclerostin (S: CAGCCTTCCGTGTAGTGG; AS:
TTCATGGTCTTGTTGTTCTCC); Osteocalcin (S: ACACTCCTCGCCCTATTG; AS:
CAGCCATTGATACAGGTAGC); GAPDH (S: TCATCCCTGCCTCTACTG; AS:
TGCTTCACCACCTTCTTG). The running conditions were: incubation at 95°C for 3 minutes, and
40 cycles of incubation at 95°C for 15 seconds and 60°C for 30 seconds. After the last cycle the melting curve analysis was performed into 55-95°C interval by incrementing the temperature of
0,5°C. The fold change values were calculated by Pfaffl method (8).
Western blot analysis.

To detect the expression of sclerostin, protein samples (15 µg) from HMCLs, as well as CD138+ cells from MM and MGUS patients were solubilised with lysis buffer [50 mM Tris
(tris(hydroxymethyl)aminomethane)–HCl (pH 8), 150 mM NaCl, 5 mM ethylenediaminetetraacetic acid, 1% NP40, and 1 mM phenylmethyl sulfonyl fluoride]. Recombinant human-sclerostin (Rhsclerostin) was loaded as positive control and B-lymphocytes isolated from healthy donors as described in the previous paragraph, were used as negative control. BMSCs were solubilized with the Thermo Scientific NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce
Biotechnology, Rockford, IL, USA) enable stepwise separation and preparation of cytoplasmic and nuclear estracts according to the manufacturer's procedures. Cytosolic extracts were used to detect the expression of COLL I, BSP-II, RANKL and OPG protein, while nuclear extracts were used to detect the expression of Fra-1, Fra-2, Jun-D and Lamin B1 protein. Protein determination was performed by BCA (bicinchoninic acid) Protein assay Reagent Kit (Pierce Biotechnology,
Rockford, MN). Cell proteins were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gel and subsequently transferred to nitrocellulose membranes
(Hybond; Amersham Pharmacia, London, United Kingdom). The blots were probed overnight at
4°C with the appropriate primary antibody. The following primary Abs were used: polyclonal anti-
COLL I, anti-BSP-II, anti-Fra-2, anti-Jun-D, anti-OPG, anti-Lamin B1, anti-ERK1/2 (at 1:200; all from Santa Cruz Biotechnology, Santa Cruz, CA), anti-RANKL (at 1:250; R&D Systems) and anti-

-catenin (at 1:400; Cell Signaling Technology); monoclonal anti-

-actin, anti-Fra-1 (at 1:200; all from Santa Cruz Biotechnology), and anti-sclerostin (at 1:250; R&D Systems). After incubation with the appropriate fluorescent-dye-conjugated secondary Ab (LI-COR Biosciences GmbH Bad
Homburg, Germany), specific reactions were revealed with the LI-COR's Odyssey Infrared Imaging
System (LI-COR Biotechnology Lincoln, Nebraska USA).
Immunoprecipitation

To detect the Sclerostin-LRP-5 or -6 complex, BMSCs, differentiated for 48 hours and co-cultured with or without HMCLs in the presence or absence of 50 or 500 ng/ml of anti-sclerostin mAb, were lysed and immunoprecipitated with anti-LRP-5 or anti-LRP-6
Ab or IgG. Briefly, 150 µg BMSCs lysates were incubated with 1 µg/mL anti-LRP-5, anti-LRP-6 or IgG for 1 hour at 4°C; then, 20 µL protein-G PLUS-agarose (Santa Cruz Biotechnology) were added and incubated with mixing overnight at 4°C. Pellets were collected by centrifugation and washed
3 times with lysis buffer.
After the final wash, the immunoprecipitated material was recovered by boiling in sample loading buffer, separated on 10% SDS-PAGE gel and revealed for the detection of Sclerostin.
Statistical analyses.
Statistical analyses were performed by Student t test with the Statistical Package for the Social
Sciences (spssx/pc) software (SPSS, Chicago, IL). The results were considered statistically significant for p values less than 0.05.