Design Your Primer
advertisement
PCR rules and Primer design PCR generally consists of cycling between different temperature that separate double stranded DNA into single strands (denaturing temperature), allow the primers to find their complementary sequences (annealing temperature) and allow the polymerase to add nucleotides in order to make the new double strand of DNA (elongation temperature). The cycling of these temperatures results in the doubling of the amount of DNA with each cycle such that after 30 cycles a lot of DNA is present in the tube. How much DNA would you have after 30 cycles if you started with one DNA strand? Denaturing Temperature and Time The specific complementary association due to hydrogen bonding of single-stranded nucleic acids is referred to as "annealing": two complementary sequences will form hydrogen bonds between their complementary bases (G to C, and A to T)and form a stable double-stranded, anti-parallel "hybrid" molecule. One may make nucleic acid single-stranded by heating it to a point above the "melting temperature" of the double-stranded form. If it is heated in buffers of ionic strength lower than 150mM NaCl, the melting temperature is generally less than 100°C - which is why PCR works with denaturing temperatures of 9197°C. Taq polymerase has an apparent half-life of 30 min at 95°C, which is partly why one should not do more than about 30 amplification cycles. Normally the denaturation time is 1 min at 94°C: it is possible, for short template sequences, such as plasmids, to reduce this to 30 sec. Annealing Temperature and Primer Design Primer length and sequence are of critical importance in designing the parameters of a successful amplification: the melting temperature of a double stranded DNA increases both with its length, and with increasing (G+C) content. Why does more GC content increase the melting temperature?—Consider how GC hydrogen bonding is different from AT hydrogen bonding. A simple formula for calculation of the Tm is Tm = 4(G + C) + 2(A + T)°C. Thus, the annealing temperature chosen for a PCR depends directly on length and nucleotide composition of the primer(s). As a general rule, the annealing temperature (Ta) of about 5°C below the lowest Tm of the primers is a good place to start testing of the primers. Annealing does not take long: most primers will anneal efficiently in 30 sec or less, unless the Ta is too close to the Tm, or unless they are unusually long. Elongation Temperature and Time This is normally 70 - 72°C, for 0.5 - 3 min. A general rule for primer extension is 1 min is sufficient for reliable amplification of 1kb. Longer products require longer times: 3 min is a good for 3kb and longer products. Longer times are also be helpful in later cycles when product concentration exceeds enzyme concentration and when dNTP and / or primer depletion becomes limiting. Primer Length A prime consideration is that the primers should be complex enough so that the likelihood of annealing to sequences other than the chosen target is very low. For example, there is a 1/4 chance (4-1) of finding an A, G, C or T in any given DNA sequence; there is a 1/16 chance (4 -2) of finding any dinucleotide sequence (e.g. AG); a 1/256 chance of finding a given 4-base sequence. Thus, a sixteen base sequence will statistically be present only once in every 416 bases (=4 294 967 296, or 4 billion): this is about the size of the human or maize genome, and 1000x greater than the genome size of E. coli. Consequently, 17-mer or longer primers are routinely used for amplification from genomic DNA of animals and plants. In general, oligonucleotides between 18 and 24 bases are extremely sequence specific G/C content and Polypyrimidine (T, C) or polypurine (A, G) stretches The base composition of primers should be between 45% and 55% GC. The primer sequence must be chosen such that long stretches of Gs and Cs are avoided, GC rich regions can promote non-specific annealing. Long AT stretches are also to be avoided as these will “breath” and open up stretches of the primer-template complex. Why would AT promote breathing? Ideally the primer will have a near random mix of nucleotides, a 50% GC content and be ~20 bases long. This will also put the Tm in the range of 56°C – 62°C. 3’-end Sequence The inclusion of one or two G and/or C residues at the 3' end of primers can provide stability to the primer annealing to the template. This “GC Clamp” helps to ensure correct binding at the 3' end due to the stronger hydrogen bonding of G/C residues. It also helps to improve the efficiency of the reaction by minimizing any “breathing” that might occur. More than two CG residues at the 3' end should be avoided, mis-priming can occur due to the stability of the GC hydrogen bonding. Melting Temperature (Tm) It is important to keep in mind that there are two primers added to a PCR reaction. Both of the oligonucleotide primers should be designed such that they have similar melting temperatures. If primers are mismatched in terms of Tm, amplification will be less efficient or may not work at all since the primer with the higher Tm will mis-prime at lower temperatures and the primer with the lower Tm may not work at higher temperatures. Examples of inter- and intra-primer binding which would result in problems: Another complication with primers can occur when primers bind to themselves (i.e. hairpin loop) or when two primers bind to each other (primer dimers). Primer dimers can occur between two of the same primers or two different primers. The best way to avoid these problems is to avoid complementary base pairing, within and between primers. Two primers binding (primer dimer): 5'-ACGTCCAAGAGGAAGCG-3' |||| 3'-ACTTACGACTTTCGAATGTAA-5' One primer binding (hairpin loop) 5'- ATGTCCAAGAGGAAGCGCCTCTT -3' ****** ****** G A C A G G*C G*C A*T G*C A*T A*T 5'-ACGTCC A simple set of rules for primer sequence design: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms between 55-70°C are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5.The Tm for your primer pair should be within 2 degrees of each other, though ideally the same. 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. In the below plasmid sequence a gene is highlighted in yellow. If you are asked to design primers to amplify this region, or most of this region, of DNA, you will need to follow the above primer design rules and design a forward and reverse primer. Below are 9 possible primer pairs, determine which primer pair is the best choice and explain why the other primers are not good choices. You will need to calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best. 1 61 121 181 241 301 361 421 atcgatgcat tccgtcaagc ttcacttttt aatacccgcg ggcatccggg cttaagacgc caaacatgct tactgacaag aatgtgcctg cgtcaattgt cttcacaacc agaaatagag tggtgctcaa taatccctaa gtgcgacgct cctcgcgtac tcaaatggac ctgattcgtt ggcacggaac ttgatcgtca aagcagcttc ctgctggcgg ggcgatatca ccgattatcc gaagcaggga accaattatg tcgctcgggc aaaccaacat gcctggctga aaaagatgtg aaattgctgt atcggtggat ttctgcaaac acaacttgac tggccccggt tgcgaccgac tacgttggtc acagacgcga ctgccaggtg ggagcgactc cctatgctac ggctacatca gcatttttta ggtggcgata ctcgcgccag cggcgacaag atcgctgatg gttaatcgct 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 1441 1501 1561 1621 1681 1741 1801 1861 1921 1981 2041 2101 2161 2221 2281 2341 2401 2461 2521 2581 2641 2701 2761 2821 2881 2941 3001 3061 3121 3181 3241 3301 3361 3421 3481 3541 3601 3661 3721 3781 3841 3901 3961 4021 4081 tccatgcgcc ccttcccctt gcttcatccg tgccagtagg tgacgaccgt acaaattctc taacctttca ggcgttaaac tgcgcttcag tgcatcagac accccgctta aacaaaagtg ctttgctatg tcgcaactct ctttaagaag ccaattcttg ggtgaaggtg ctacctgttc cgttatccgg gtacaggaac aagtttgaag gatggaaaca acggcagaca gatggatccg gtccttttac gaaaagcgtg atggatgagc cctgcaggca gattaaatca ggtggtccca tgtggggtcc gtgcaaagac gacaaatccg aggacgcccg cctttttgcg gctcatgaga tattcaacat tgctcaccca gggttacatc acgttttcca tgacgccggg gtactcacca tgctgccata accgaaggag ttgggaaccg agcaatggca gcaacaatta ccttccggct tatcattgca ggggagtcag gattaagcat cgccctgtag cacttgccag tcgccggctt ctttacggca cgccctgata tcttgttcca ggattttgcc cgaattttaa gataatctca gtagaaaaga gcagtaacaa gcccggcgtt ggcgaaagaa cgcgcggacg agtgatgaat gtccctgatt ttcccagcgg ccgccaccag ccatactttt attgccgtca ttaaaagcat tctataatca ccatagcatt ctactgtttc gagatataca ttgaattaga atgctacata catggccaac atcatatgaa gcactatatc gtgataccct ttctcggaca aacaaaagaa ttcaactagc cagacaacca accacatggt tctacaaata tgcaagcttg gaacgcagaa cctgacccca cccatgcgag tgggcctttc ccgggagcgg ccataaactg tttctacaaa caataaccct ttccgtgtcg gaaacgctgg gaactggatc atgatgagca caagagcaac gtcacagaaa accatgagtg ctaaccgctt gagctgaatg acaacgttgc atagactgga ggctggttta gcactggggc gcaactatgg tggtaactgt cggcgcatta cgccctagcg tccccgtcaa cctcgacccc gacggttttt aactggaaca gatttcggcc caaaatatta tgaccaaaat tcaaaggatc ttgctcaagc aatgatttgc ccccgtattg aaagtaaacc ctctcctggc tttcaccacc tcggtcgata atgggcatta catactcccg ctgcgtcttt tctgtaacaa cggcagaaaa tttatccata tccatacccg tatggctagc tggtgatgtt cggaaagctt acttgtcact acggcatgac tttcaaagat tgttaatcgt caaactcgag tggaatcaaa agaccattat ttacctgtcg ccttcttgag atgaattcga gctgttttgg gcggtctgat tgccgaactc agtagggaac gttttatctg atttgaacgt ccaggcatca ctctttgttt gataaatgct cccttattcc tgaaagtaaa tcaacagcgg cttttaaagt tcggtcgccg agcatcttac ataacactgc ttttgcacaa aagccatacc gcaaactatt tggaggcgga ttgctgataa cagatggtaa atgaacgaaa cagaccaagt agcgcggcgg cccgctcctt gctctaaatc aaaaaacttg cgccctttga acactcaacc tattggttaa acgtttacaa cccttaacgt ttcttgagat agatttatcg ccaaacaggt gcaaatattg cactggtgat gggaacagca ccctgaccgc aaaaaatcga aacgagtatc ccattcagag tactggctct agcgggacca gtccacattg agattagcgg tttttttggg aaaggagaag aatgggcaca acccttaaat actttctctt tttttcaaga gacgggaact atcgagttaa tacaactata gctaacttca caacaaaata acacaatctg tttgtaactg gctcggtacc cggatgagag aaaacagaat agaagtgaaa tgccaggcat ttgtttgtcg tgcgaagcaa aattaagcag atttttctaa tcaataatat cttttttgcg agatgctgaa taagatcctt tctgctatgt catacactat ggatggcatg ggccaactta catgggggat aaacgacgag aactggcgaa taaagttgca atctggagcc gccctcccgt tagacagatc ttactcatat gtgtggtggt tcgctttctt gggggctccc atttgggtga cgttggagtc ctatctcggg aaaatgagct tttaaaagga gagttttcgt cctttttttc ccagcagctc cgctgaaatg acggccagtt accattcgcg aaatatcacc gaatggtgag gataaccgtt ccggcagcag aagaaaccaa tctcgctaac aagccatgac attatttgca atcctacctg ctagaaataa aacttttcac aattttctgt ttatttgcac atggtgttca gtgccatgcc acaagacgcg aaggtattga actcacacaa aaattcgcca ctccaattgg ccctttcgaa ctgctgggat cggggatcct aagattttca ttgcctggcg cgccgtagcg caaataaaac gtgaacgctc cggcccggag aaggccatcc atacattcaa tgaaaaagga gcattttgcc gatcagttgg gagagttttc ggcgcggtat tctcagaatg acagtaagag cttctgacaa catgtaactc cgtgacacca ctacttactc ggaccacttc ggtgagcgtg atcgtagtta gctgagatag atactttaga tacgcgcagc cccttccttt tttagggttc tggttcacgt cacgttcttt ctattctttt gatttaacaa tctaggtgaa tccactgagc tgcgcgtaat cgaatagcgc cggctggtgc aagccattca agcctccgga cggtcggcaa attgagaata ggcctcaatc gggatcattt ttgtccatat caaaccggta aaaaacgcgt cggcgtcaca acgcttttta ttttgtttaa tggagttgtc cagtggagag tactggaaaa atgcttttcc cgaaggttat tgctgaagtc ttttaaagaa tgtatacatc caacattgaa cgatggccct agatcccaac tacacatggc ctagagtcga gcctgataca gcagtagcgc ccgatggtag gaaaggctca tcctgagtag ggtggcgggc tgacggatgg atatgtatcc agagtatgag ttcctgtttt gtgcacgagt gccccgaaga tatcccgtgt acttggttga aattatgcag cgatcggagg gccttgatcg cgatgcctgc tagcttcccg tgcgctcggc ggtctcgcgg tctacacgac gtgcctcact ttgatttacg gtgaccgcta ctcgccacgt cgatttagtg agtgggccat aatagtggac gatttataag aaatttaacg gatccttttt gtcagacccc ctgctgcttg 4141 4201 4261 4321 4381 4441 4501 4561 4621 4681 4741 4801 4861 4921 4981 5041 5101 5161 5221 5281 5341 caaacaaaaa ctttttccga tagccgtagt ctaatcctgt tcaagacgat cagcccagct gaaagcgcca ggaacaggag gtcgggtttc agcctatgga tttgctcaca tttgagtgag gaggaagcgg caccgcatat acactccgct ctgacgcgcc tctccgggag aaggagatgg caagcgctca taggcgccag aggatctaat aaccaccgct aggtaactgg taggccacca taccagtggc agttaccgga tggagcgaac cgcttcccga agcgcacgag gccacctctg aaaacgccag tgttctttcc ctgataccgc aagagcgcct ggtgcactct atcgctacgt ctgacgggct ctgcatgtgt cgcccaacag tgagcccgaa caaccgcacc tctcatgttt accagcggtg cttcagcaga cttcaagaac tgctgccagt taaggcgcag gacctacacc agggagaaag ggagcttcca acttgagcgt caacgcggcc tgcgttatcc tcgccgcagc gatgcggtat cagtacaatc gactgggtca tgtctgctcc cagaggtttt tcccccggcc gtggcgagcc tgtggcgccg gacagcttat Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm = Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm = Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm = Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm = Forward 3: 5’ agattagcggatcctacctg 3’ Tm = Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm = Forward 4: 5’ cattgattatttgcacggcg 3’ Tm = Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm = Forward 5: 5’ tccataagattagcggatcc 3’ Tm = Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm = Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm= Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm = Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm = Reverse 7: 5’aggtcgactctagaggatc 3’ Tm = Forward 8: 5’ctacctgttccatggccaac 3’ Tm= Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm= Forward 9: 5’ tccataagattagcggatcc 3’ Tm = Reverse 9: 5’ tctcgcatgggggaccccac 3’Tm = gtttgtttgc gcgcagatac tctgtagcac ggcgataagt cggtcgggct gaactgagat gcggacaggt gggggaaacg cgatttttgt tttttacggt cctgattctg cgaacgaccg tttctcctta tgctctgatg tggctgcgcc cggcatccgc caccgtcatc acggggcctg cgatcttccc gtgatgccgg c cggatcaaga caaatactgt cgcctacata cgtgtcttac gaacgggggg acctacagcg atccggtaag cctggtatct gatgctcgtc tcctggcctt tggataaccg agcgcagcga cgcatctgtg ccgcatagtt ccgacacccg ttacagacaa accgaaacgc ccaccatacc catcggtgat ccacgatgcg gctaccaact ccttctagtg cctcgctctg cgggttggac ttcgtgcaca tgagctatga cggcagggtc ttatagtcct aggggggcgg ttgctggcct tattaccgcc gtcagtgagc cggtatttca aagccagtat ccaacacccg gctgtgaccg gcgaggcagc cacgccgaaa gtcggcgata tccggcgtag
