Ascorbic Acid Attenuates Lipopolysaccharide Induced Acute Lung
Injury
Bernard J. Fisher, Ignacio M. Seropian, Donatas Kraskauskas, Jay N. Thakkar, Norbert
F. Voelkel, Alpha A. Fowler III and Ramesh Natarajan
ONLINE DATA SUPPLEMENT
ADDITIONAL METHODS
Reagents and Chemicals
LPS from Escherichia coli 0111:B4, AA, DHA, pentobarbital, protease and
phosphatase inhibitor cocktails and other chemicals were purchased from SigmaAldrich (St. Louis, MO, USA). The Biopulverizer was purchased from Biospec,
Bartlesville, OK. Culture media, serum, NuPAGE™ Novex pre-cast gel system and
primers were obtained from GIBCO-Invitrogen (Carlsbad, CA). Sterile tissue culture
plasticware was obtained from Corning (Corning, NY). The RNA isolation kit RNeasy™
Mini and QIAshredder™ were obtained from Qiagen (Valencia, CA). High Capacity
cDNA Reverse Transcription kit and POWER SYBR Green QPCR Master Mix were
obtained from Applied Biosystems Inc. (Foster City, CA). The Renaissance Western
Blot Chemiluminescence Reagent Plus was purchased from Perkin Elmer Life Sciences
Inc (Boston, MA). Rabbit polyclonal antibodies to lamin B (sc-6216), actin (sc-1616),
and NFB p65 (sc-372) were obtained from Santa Cruz Biotechnology (Santa Cruz,
CA). Immobilon membranes were obtained from Millipore (Bedford, MA). Blots were
stripped using the Restore™ Western Blot Stripping Buffer (Pierce Biotechnology) as
described by the manufacturer.The Vectastain® Elite ABC kit and DAB substrate kit
were obtained from Vector Laboratories (Burlingame, CA).
Endothelial Cell Culture
HMEC-1 cells were cultured in medium MCDB-131 supplemented with 10% FBS,
hydrocortisone (1 µg/ml), and epidermal cell growth factor (10 ng/ml) under a 5% CO2
atmosphere at 37ºC. For total RNA preparation and nuclear/cytosolic extracts HMEC-1
were cultured in 35 mm (9.6 cm²) dishes.
Western Blot Analysis
Proteins were resolved by SDS polyacrylamide gel electrophoresis (4-20%) and
electrophoretically transferred to polyvinylidene fluoride membranes (0.2µm pore size).
Immunodetection was performed using chemiluminescent detection. Blots were stripped
using the Restore™ Western Blot Stripping Buffer as described by the manufacturer.
RNA Isolation and Real Time Quantitative PCR (QPCR) Analysis
Total RNA was extracted and purified using QIAshredders™ and RNeasy™ columns
according to the manufacturer’s specifications (Qiagen). Murine lungs were snap frozen
in liquid nitrogen and subsequently powdered with a Biopulverizer (RPI) prior to RNA
extraction. Total RNA (1µg) was reverse transcribed into cDNA using the High Capacity
cDNA Reverse Transcription kit. Complimentary DNA (cDNA) was diluted (1:500) and
real time QPCR performed using POWER SYBR Green QPCR Master Mix along with
primers (Supplement Table 1, see below). Primers were designed to anneal to
sequences on separate exons or to span two exons. Cycling parameters were: 95ºC, 10
min, 40 cycles of 95ºC, 15 sec; 60ºC, 1min. A dissociation profile was generated after
each run to verify specificity of amplification. All PCR assays were performed in
triplicate. No template controls and no reverse transcriptase controls were included.
Beta-actin was used as housekeeping gene against which all the samples were
normalized for differences in the amount of total RNA added to each cDNA reaction and
for variation in the reverse transcriptase efficiency among the different cDNA reactions.
Automated gene expression analysis was performed using the Comparative
Quantitation module of MxPro QPCR Software (Stratagene).
Supplement Table 1
Name
Sequence 5’ to 3’
Product size
KC forward
KC reverse
CAATGAGCTGCGCTGTCAGTGCCTGCAG
CTGAACCAAGGGAGCTTCAGGGTC
168bp
MIP-2 forward
MIP-2 reverse
CTGGGGAGAGGGTGAGTTG
GCTGTTCTACTCTCCTCGGTG
166bp
LIX forward
LIX reverse
GCGTTGTGTTTGCTTAACCGTAACTCC
AGTTTAGCTATGACTTCCACCGTAGGGC
110bp
Mpo forward
Mpo reverse
CTGGATCATGACATCACCTTGACTCC
215bp
GATCTGGTTGCGAATGGTGATGTTGTTCC
-actin forward
-actin reverse

MCP-1 forward
MCP-1 reverse
TCTACGAGGGCTATGCTCTCC
TCTTTGATGTCACGCACGATTTC
125bp
TTCTGGGCCTGCTGTTCACAG
CCAGCCTACTCATTGGGATCATCTTGC
125bp