Supporting Information Legends
Figure S1. Root phenotype of the mcr1 mutant.
(a) Root meristem zone of WT and mcr1 mutant plants at 6 days after germination (DAG). ‘c’
denotes cortex cells. Bars = 100 μm. (b) Number of mature epidermal cells in WT and mcr1
mutant plants from 3 to 10 DAG. Error bars represent SD. Asterisks denote significant differences
by Student’s t-test compared with WT (*, P < 0.05; **, P < 0.01). (c) Length of mature epidermal
cells in WT and mcr1 mutant plants from 3 to 10 DAG. Error bars represent SD. Asterisks denote
significant differences by Student’s t-test compared with WT (*, P < 0.05). (d) Mature zone of
WT and mcr1 mutant plants. *, indicates the cortex cells. Bars = 20 μm. (e) Primary root length of
WT and mcr1 mutant plants from 7 to 27 DAG. Error bars represent SD. Asterisks denote
significant differences by Student’s t-test compared with WT (**, P < 0.01). (f) Root meristem
zone of WT and mcr1 mutant plants at 30 DAG. Bars = 100 μm.
Figure S2. The mcr1 mutation represented a new prl1 allele
(a) The junction sequence of T-DNA (the left border of pER16 Vector) insertion identified in the
prl1-9 by sequencing. The plant gene sequence is in capital and the T-DNA sequence is in lower
case letter. T-DNA insertion results in a fragment (ttacaccacaatatatcctgccac, 24bp) deletion in the
left border of pER16 vector during transformation. (b) Six-day-old seedlings grown on MS
medium. gPRL1-GFP;mcr1 plants show the similar root length with WT and gPRL1-GFP plants.
Bar = 1 cm.
Figure S3. Mitotic index in the RAM of WT and prl1-9 seedlings.
The mitotic index is the number of mitotic figures (metaphase, anaphase, and telophase cells) in
root meristem cells. About 80 cortex and endodermis cells of 6-day-old wild type and prl1-9
seedlings grown on MS medium were analyzed. Totally 20 plants of each genotype were
examined. Error bars represent SD. Asterisk denotes significant differences by Student’s t-test
compared with WT (*, P < 0.05).
Figure S4. DR5:GUS expression in prl1-9 cotyledons.
Six-day-old seedlings of the WT and prl1-9 mutant grown on MS medium were analyzed by GUS
staining for 2 h. Rectangles indicate the GUS staining positions. Bars = 1 mm
Figure S5. WOX5 expression is diminished in the prl1-9 mutant.
GUS staining of 4-week-old wild type and prl1-9 mutant plants expressing WOX5pro:GUS. Bars
= 50 μm.
Figure S6. PLT1 and PLT2 gene expression analysis.
Quantitative real-time analysis of PLT1 and PLT2 gene expression in the wild type and prl1-9
expressing PLT1pro:PLT1-GFP and PLT2pro:PLT2-GFP, respectively. Root tips of 6-day-old
seedlings were collected and analyzed by qRT-PCR. The values given are means ± SD (*, P <
0.05, t-test).
Figure S7. PRL1 acts independently of SHR/SCR pathway.
(a) Root meristems of WT, WS-2, prl1-9, scr-1 (WS-2 assession), shr-2, scr-1prl1-9, and
shr-2prl1-9 seedlings at 6 DAG. Red arrowheads indicate the cortex transition zone. (b) Average
number of cortical cells in the root meristems of WT, WS-2, prl1-9, shr-2, scr-1, shr-2prl1-9, and
scr-1prl1-9 seedlings at 6 DAG. The values given are means ± SD. Different letters shows the
significant differences with One Way ANOVA analysis (P < 0.05). (c) and (d) Expression pattern
of SHRpro:SHR-GFP in the root tips of WT and prl1-9 plants at 6 DAG (c), and the expression
pattern of SCRpro:SCR-GFP in WT and prl1-9 plant root tips at 6 DAG (d). Bars = 80 μm.
Table S1. Primers used in this study.