Cloning Insertion Sites by Splinkerette PCR protocol based on Devon et al. (1995) Nucleic
23:1644-1645 and Mikkers et al. (2002) Nature
for questions/suggestions e-mail Anthony Uren
Updated June 2005
Acids Research
Genetics 32:153-159
a.uren@nki.nl
Splinkerette Ligation
Digest 1-3ug genomic DNA at 100ng/ul with enzyme of choice and heat
inactivate.
6 base cutter average length = 4096bp, 1ug DNA = 0.4 pmole
5 base cutter average length = 1024bp, 1ug DNA = 1.6 pmole
4 base cutter average length = 256bp, 1ug DNA = 6.4 pmole
We cut for 12+ hours with more than the recommended number of units
to ensure complete digestion. We normally use SauIIIA and Tsp509I,
giving GATC or AATT lower strand 5’ overhangs (SauIIIA we
inactivate for 20minutes at 65, Tsp509I for 20 minutes at 85).
Doing two ligations/PCRs using two different enzymes (eg. SauIIIA
and Tsp509I) yields more insertions from each tumour than using
just one enzyme. The amount of redundancy seen between two enzymes
varies from tumour to tumour. Tsp509I seems to give us better
results than SauIIA. Have not tested other 4 base cutters.
6 or 5 base cutters usually give a better distribution of fragment
sizes over a gel but a 4 base cutter but will usually give more
insertion sites overall.
Splinkerette adaptor
Top strand primer “Splinklong”
5’ cga aga gta acc gtt gct agg aga gac cgt ggc tga atg aga ctg gtg
tcg aca cta gtg g
Lower strand primer/hairpin “Splinkshort-GATC” (has GATC overhang
in this case)
5’ gatccc act agt gtc gac acc agt ctc taa ttt ttt ttt tca aaa aaa
Dilute and mix splinkerette adaptor oligos at highest concentration
possible in 1x Boehringer RE buffer M (10mM TrisHCl, 10mM MgCl2
50mM NaCl pH7.5)
Use thermal cycler to denature at 95oC for 3 min followed by
cooling to room temp at 1oC per 15 sec (4oC per min).
Dilute annealed splinkerette to 4pmol/ul.
Ligation
Immediately before setting up ligation, heat DNA to 60oC and put on
ice.
This is supposed to melt annealed sticky so they are free for
ligation. I haven’t checked whether it really helps.
Use
6bp
5bp
4bp
Mix
300ng cut DNA
cutter = 0.12 pmole
cutter = 0.48 pmole
cutter = 1.92 pmole
-
300 ng cut DNA
10x molar excess of splinkerette
4U T4 ligase (Roche)
4ul 10x buffer
H2O to 40ul
Incubate overnight at 16 degrees.
EcoRV Digestion
Inactivate ligase at 65 degrees C for 20 minutes.
Cut 40ul ligation with 10U EcoRV in 100ul for 3+ hours.
Inactivate 20 mins at 65 degrees.
This step prevents amplification of internal Moloney MuLV fragments
from the internal U3 LTR sequence by cutting an EcoRV site 100
bases in from the internal U3 LTR. If your primers are in a
sequence that is repeated internally (in this case the U3LTR) you
will need to find an appropriate enzyme to prevent amplification of
internal fragments i.e. any enzyme that is closer to your internal
primer than the enzyme you are using for the splinkerette, in this
case EcoRV is closer to the internal LTR than SauIIIA or Tsp509I.
Ligation cleanup
Desalt/concentrate in Microcon YM-30
Some samples spin down much slower than others. Usually to keep
volumes similar between samples we spin everything dry and add 50ul
water, wait 10mins and then collect sample.
For individual columns add 400ul H2O, microfuge ~ 10min at
14000RPM/20,000g.
For 96 column retentate assembly add 150ul H2O, centrifuge ~ 20min
at 4000RPM/3000g
You can quantiate the DNA in the ligation or you can just proceed
assuming 100% recovery of DNA from column. PCRs usually work OK
when you assume 100% recovery.
If quantitating, Microcon columns leave you with a high 260/280
ratio. Hoechst or Pico green quantitation is probably better than
A260/A280. Residual linker may also affect quantiation but doesn’t
seem to influence PCR.
Amplification
1o PCR
4U Pfu
Volume
100ng ligated DNA (about 1/3 of total ligation)
200nM each primer (Splink1 and LTR#5)
200uM dNTPs
1-4U Pfu Turbo hotstart (Stratagene)
1x Pfu Turbo buffer (with 2.0mM MgCl2 included)
H2O to 50 ul
Turbo seems best but this is expensive. Can also use
1U Pfu Turbo in 2mM MgCl2
1U Expand High Fidelity Plus (Roche) in 1.75mM MgCl2
1U of Finnzymes Phu “Phusion” with 1.5mM MgCl2.
of reaction can also be reduced to cut enzyme costs.
Using PTC 100 Perkin Elmer
3min 94o
15sec 94o, 30sec 68o, 5min 72o
15sec 94o, 30sec 66o, 5min 72o
5min 72o
x
x
x
x
1
2
27
1
Can shorten extension time to 3min 30sec but 5 min is slightly
better (at least for Pfu). Other higher processivity or less thermo
stable enzymes might require shorter extensions times.
2o PCR
-
2ul of 1o PCR as template (0.5-2ul works just as well)
200nM each primer (Splink2 and LTR#3 or LTR#1)
25ul Qiagen Multiplex PCR kit mix
H2O to 50ul
Qiagen Multiplex gives slightly better signal for larger fragments
and for fainter bands but is more expensive. Can also lower the
volume to 25ul or use 1U Taq (Invitrogen) with 1.75mM MgCl2, 200nM
dNTPs.
Using PTC 100 Perkin Elmer
15min* 94o
15sec 94o, 30sec 60o, 3min 72o
5min 72o
x 1
x 25
x 1
*15min start step is only required for Qiagen enzyme. For Taq use
3min.
To look at PCRs
Running PCR on 3-4% agarose gel should (depending on the DNA) give
you a ladder of fragments ranging from 50bp to 1500bp.
Can use FAM labeled 2o PCR primers and run 2ul on capillary
sequencer along with size marker to give a better estimate of
fragment sizes.
Bands can be cut from a 4% agarose gel and in some cases sequenced
directly or in other cases reamplified/subcloned and then
sequenced.
For better separation of bands use radiolabelled PCRs run on a
polyacrylamide gel.
Radioactive amplification
(taken from Harald Mikkers protocol)
1o PCR - Label primer with 32P-gamma using PNK. Use 10pmol of
radioactively labeled primer. Fragments are separated on a 3.5%
denaturing acrylamide gel (separation of 100bps-1000 bps). Dry gel,
expose to a film and excise radioactive fragments. Put the samples
into 100 ul TE and heat the excised fragments for 15’ at 94oC. Use
1:100 of this mixture for a nested cold reaction or if a tumor
contains a lot of integrations a second radioactive PCR might be
required.
2o PCR - Similar as previously described except for the number of
cycles. Use 1 pmol of radioactively labeled primer. Fragments are
separated on a 3.5% denaturing acrylamide gel (separation of 100bps1000 bps). Dry gel, expose to a film and excise radioactive
fragments. Put the excised fragments into 100 ul TE and heat for 15’
at 94oC. Use 1:100 of this mixture for a cold reaction.
Shotgun subcloning (less effort but more expensive)
Prior to TA cloning PCR products can be cleaned up using Microspin
S-300 HR columns (Amersham) for individual samples or GFX-96 PCR
Purification columns (Amersham) for a 96 well plate full of
samples.
Freeze until ready to ligate
Topo TA vector shotgun subcloning (Invitrogen)
(Method from Invitrogen/Sanger)
Put 1ul of PCR product in each tube.
Dilute the salt solution provided with topo kit 1 in 4.
Note: The use of ¼ strength salt solution allows the ligation to be
incubated longer than without salt, but is dilute enough for
electroporation of 1ul of ligation without arcing.
Mix up the following:
Per reaction:
1ul of dilute salt solution
3.9ul of H2O (from kit)
0.14ul Topo TA vector (i.e. 1/7 of recommended amount)
Per 48 reactions:
50ul of dilute salt solution
195ul of H2O (from kit)
7ul of Topo TA vector (i.e. 1/7 of recommended amount)
Add 5ul of master mix to each tube containing 1ul PCR product.
Incubate 20 min at room temperature and stop reaction by freezing
at -80 degrees.
Note: Using only 1/10 - 1/7 of the recommended amount of vector
means that the vector is limiting in the ligation and the PCR
product is in excess. This means most ligations will yield similar
numbers of transformants regardless of variability in the amount of
DNA in the PCR product.
Method used to transform the ligation will determine how much of it
should be used. Using 1ul for electroporation (Invitrogen
electromax DH10Bs or Topo10s) yields over 500 colonies.
The number of clones which need to be sequenced to identify the
majority of prominent bands in the PCR will depend on the
complexity of the PCR. Doing a second splinkerette ligation/PCR
using another restriction enzyme will usually yield more new
sequences than just increasing numbers of clones sequenced for one
PCR.
Primer sequences
1o PCRs
- Splink1 cga aga gta acc gtt gct agg aga gac c
2o PCRs
- Splink2 gtg gct gaa tga gac tgg tgt cga c
Vector/virus primers will vary depending on what vector/virus you
are retrieving. Test primers on infected and uninfected DNA to find
ones which give the most acceptable combination of good signal vs.
minimum amplification of endogenous virus like sequences (large
amounts of the mouse genome consists of retrovirus/LTR like
sequences).
If you want to sequence from the PCR product itself it is good to
have primers set back from the insertion site so you can see the
exact base of integration.
We find quality of the oligos can affect the results. Start by
ordering a few separate batches from different suppliers. Each new
batch of primer should be tested against an older batch which you
know works. HPLC puried oligos aren’t necessarily better than
desalted ones, we just see large amounts of batch to batch
variation.Moloney U3LTR primers
Have tried a range of Splinkerette and U3 LTR primers and changing
these doesn’t seem to matter too much so long as there is
sufficient nesting (6bp or more). We use LTR#5 for the primary and
LTR#3 or LTR#1 for the secondary. U3LTR#1 might be giving us the
most signal for a secondary PCR.
U3 LTR sequence
EcoRV
SauIIIA
GATATCCTGTTTGGCCCATATTCAGCTGTTCCATCTGTTCCTGACCTTGATCTGAACTTCTCTATTCTCAGTTATG……
U3 LTR#8
TTCCTGACCTTGATCTGAACTTCTCTATTCTC
U3 LTR#7
CCTGACCTTGATCTGAACTTCTCTATTCTCA
U3 LTR#6
CTGACCTTGATCTGAACTTCTCTATTCTCAGTTAT
……TATTTTTCCATGCCTTGCAAAATGGCGTTACTTAAGCTAGCTTGCCAAACCTACAGGTGGGGTCTTTCATT -LTR endU3 LTR#5
GCGTTACTTAAGCTAGCTTGCCAAACCTAC
U3 LTR#4
CGTTACTTAAGCTAGCTTGCCAAACCTACA
U3 LTR#3/AB949
GCTAGCTTGCCAAACCTACAGGTGG
U3 LTR#2
TTGCCAAACCTACAGGTGGGGTCT
HM001
GCCAAACCTACAGGTGGGGTCTTT
U3 LTR#1
CCAAACCTACAGGTGGGGTCTTTC