MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
SUPPLEMENTAL INFORMATION
MATERIAL AND METHODS
Preparation of biological samples
Peripheral leukocytes express TLR-4 and could be a significant source of proinflammatory mediators
after stress exposure. To manage this possible confounding factor, a group of stressed animals was
transcardially saline-perfused prior to collection of brain tissue. This group of animals did not present
differences in TLR-4, iNOS and COX-2 expression in brain homogenate samples compared to the group of
stressed animals without prior saline perfusion.
Rat brain prefrontal cortex was chosen because of its high levels of pro-inflammatory/antiinflammatory mediators, its susceptibility to the neuroinflammatory process elicited by stress (Herbert and
Cohen, 1993) and finally because this brain area is an important neural substrate for the regulation of the
hypothalamo-pituitary- adrenal axis response to stress (Radley et al., 2006). Furthermore, some cognitive
deficits and alterations in the neuronal circuitry of the prefrontal cortex, including dopamine
neurotransmission disturbances have been described in schizophrenia (Volk and Lewis, 2010).
Preparation of nuclear extracts
Tissues (brain prefrontal cortex) were homogenized in 300 μL buffer [10 mmol/L N-2hydroxyethylpiperazine-N-2-ethanesulfonic acid (pH 7.9); 1 mmol/L EDTA, 1 mmol/L EGTA, 10 mmol/L KCl,
1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethylsulfonyl fluoride, 0.1 mg/mL aprotinin, 1 mg/mL
leupeptin, 1 mg/mL Na-p-tosyll-lysine-chloromethyl ketone, 5 mmol/L NaF, 1 mmol/L NaVO4, 0.5 mol/L
sucrose, and 10 mmol/L Na2MoO4]. After 15 min, Nonidet P-40 (Roche, Mannheim, Germany) was added
to reach a 0.5% concentration. The tubes were gently vortexed for 15 sec, and nuclei were collected by
centrifugation at 8000g for 5 min. Supernatants were considered as the cytosolic fraction. The pellets were
resuspended in 100μL buffer supplemented with 20% glycerol and 0.4mol/L KCl and gently shaken for 30
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
min at 4ºC. Nuclear protein extracts were obtained by centrifugation at 13,000g for 5 min, and aliquots of
the supernatant were stored at -80ºC. All steps of the fractionation were carried out at 4ºC.
Western Blot Analysis
After adjusting protein levels, homogenates or nuclear/cytosolic extracts of prefrontal cortex tissue
were mixed with Laemmli sample buffer (Bio-Rad, Hercules, CA) (SDS 10%, distilled H2O, 50% glycerol, 1M
Tris HCl, pH 6.8, dithiothreitol, and blue bromophenol) with β-mercaptoethanol (50 µl/ml of Laemmli) and
20 µl (1µg/µl) were loaded into an electrophoresis gel. Once separated on the basis of molecular weight,
proteins from the gels were blotted onto a nitrocellulose membrane (Amersham Ibérica, Spain) with a
semi-dry transfer system (Bio-Rad) and were incubated with specific antibodies: (1) TLR4 goat polyclonal
antibody dilution of 1:1000 in 1,0% BSA in TBStween (sc-16240, Santa Cruz Biotechnology); (2) rabbit
polyclonal MyD88 antibody dilution of 1:750 in 5,0% BSA (ab2064, abcam); (3) rabbit polyclonal MD-2
antibody dilution of 1:500 in 2,5% BSA (sc20668, Santa Cruz Biotechnology); (4) rabbit polyclonal IBα in a
dilution of 1:1000 in in TBStween (sc-371, Santa Cruz Biotechnology) (5) rabbit polyclonal NFB p65
dilution of 1:800 in BSA 1% (sc-109, Santa Cruz Biotechnology); (6) iNOS rabbit polyclonal antibody dilution
of 1:1000 in 2,5% BSA in TBStween (sc-650, Santa Cruz Biotechnology); (7) COX-2 goat polyclonal antibody
dilution of 1:1000 in 2,5% BSA in TBStween (sc-1747, Santa Cruz Biotechnology); (8) mPGES-1 mouse
monoclonal antibody in a dilution 1:1000 in TBStween (10004350, Cayman Chemical Europe, Tallinn,
Estonia; (9) rabbit polyclonal HSP60 antibody in a dilution 1:1000 in TBStween (sc-13966, Santa Cruz
Biotechnology); (10) goat polyclonal HSP70 antibody in a dilution 1:1000 in TBStween (sc-1060, Santa Cruz
Biotechnology); (11) goat polyclonal HMGB1 antibody in a dilution 1:1000 in TBStween (sc-26351, Santa
Cruz Biotechnology); (12) mouse monoclonal β-actin antibody in a dilution 1:20000 (Clone AC-15, Sigma,
Madrid, Spain); (13) mouse monoclonal GAPDH antibody in a dilution 1:5000 (G8795, Sigma).
Proteins were recognized by the respective horseradish peroxidase-linked secondary antibodies (in
a dilution of 1:2000 in TBS-Tween) and visualized on X-ray film by chemiluminescence following
manufacturer’s instructions (Amersham). Autoradiographs were quantified by densitometry (program
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
Image J, NIH), and several time expositions were analyzed to ensure the linearity of the band intensities. In
all the WB analyses, the housekeeping gene β-actin or GAPDH was used as a loading control (the blots are
shown in the respective figures).
Real Time-Polymerase Chain Reaction Analysis
Quantitative changes in mRNA levels were estimated by real-time PCR (Q-PCR) using the following
cycling conditions: 35 cycles of denaturation at 95ºC for 10 s, annealing at 58–61ºC for 15s, depending on
the specific set of primers for IL1β, TNFα, TLR4, MyD88, MD-2, IBα, NFB, iNOS, COX-2, mPGES-1, GADPH
and tubulin (Table S1), and extension at 72ºC for 20s. Reactions were carried out in the presence of SYBR
green (1:10000 dilution of stock solution from Molecular Probes, Eugene, OR), carried out in a 20 µl
reaction in a Corbett Rotor-Gene (Corbett Research, Mortlake, NSW, Australia). Relative mRNA
concentrations were calculated from the take-off point of reactions using the included software, GADPH
and tubulin levels were used to normalize data
Forward primers (5'-3')
Reverse primers (5'-3')
IL1β
ACCTGCTAGTGTGTGATGTTCCCA
AGGTGGAGAGCTTTCAGCTCACAT
TNFα
CTGGCCAATGGCATGGATCTCAAA
ATGAAATGGCAAATCGGCTGACGG
TLR4
ACATCAGAGGAAGAACAAGAAGCA
CGGAAATTGTAAACATAATGGGTTT
MyD88
AAGTTTGCTCTCAGCCTGTCTCCA
TGCAAGGGTTGGTATAGTCGCAGA
MD-2
CATAGAATTGCCGAAGCGCAAGGA
ACACATCTGTGATGGCCCTTAGGA
IκBα
TGGCCTTCCTCAACTTCCAGAACA
TCAGGATCACAGCCAGCTTTCAGA
NFB
CATGCGTTTCCGTTACAAGTGCGA
TGGGTGCGTCTTAGTGGTATCTGT
iNOS
GGACCACCTCTATCAGGAA
CCTCATGATAACGTTTCTGGC
COX-2
CTTCGGGAGCACAACAGAG
GCGGATGCCAGTGATAGAG
mPGES-1
GGTGAAGCAAATGTTCCCAGCTCA
TTTAGCGGTTGGTCAAAGCCCATC
HSP60
ACCTGTGACAACCCCTGAAG
TGACACCCTTTCTTCCAACC
HSP70
CAAGATCACCATCACCAACG
TAGGACTCGAGCGCATTCTT
HMGB1
TGTAATGCCTTTGCCCTTCT
AAGCAAATGGCTTGGACAAC
Tubulin
CCCTCGCCATGGTAAATACAT
ACTGGATGGTACGCTTGGTCT
GAPDH
TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
Table S1. Specific primers for real-time polymerase chain reaction in brain prefrontal cortex tissue. IL1β,
Interleukin 1β; TNF-α, tumour necrosis factor α; TLR4, Toll like receptor 4; MyD88, myeloid differentiation
factor 88; MD-2, myeloid differentiation protein-2; IκBα, NF-κB inhibitory protein; NF-κB, nuclear
transcription factor κB; iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase 2; m-PGES-1,
microsomal prostaglandin E synthase; HSP60, heat shock proteins 60; HSP70, heat shock proteins 70;
HMGB1, High mobility group proteins 1
PGE2 levels
Samples were sonicated in 400 µl of homogenization buffer (0.1M phosphate buffer, pH, 7.4, 1mM
EDTA, and 10 mM indomethacin) and purified in 4 volume of ethanol for 5 min at 4ºC. After that, samples
were centrifugated at 3000 g for 10 min and acidified with glacial acetic acid (pH 3.5). Prostaglandin
compound was then extracted using SPE (C-18) columns (Waters, Milford, Massachusetts, USA) rinsed with
methanol and water. After the application of samples, columns were washed with water and hexane, and
PGE2 was eluted with ethyl acetate. Samples were then evaporated to dryness under nitrogen and
resuspended in EIA buffer. Levels of PGE2 were measured in a 96-well plate and read at 405 nm following
manufacturer’s instructions (Synergy 2, BioTek). The sensitivity of the assay for PGE2 was 15 pg/ml; intraand interassay coefficients of variation were 6.6 and 15.5%, respectively, at 62.5 pg/ml.
Nitrites (NO2-) levels
Briefly, in an acidic solution with 1% sulphanilamide and 0.1% NEDA, nitrites convert into a pink
compound that is photometrically calculated at 540 nm in a microplate reader (Synergy 2; BioTek, USA).
The results were expressed as µmol/mg of protein.
-Lipid Peroxidation
Brain prefrontal cortex samples were sonicated in 10 vol of 50 mmol/l phosphate buffer and
deproteinized with 40% trichloroacetic acid and 5 mol/l HCl, followed by the addition of 2% (wt/vol)
thiobarbituric acid in 0.5 mol/l NaOH. The reaction mixture was heated in a waterbath at 90ºC for 15 min
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
and centrifuged at 12000rpm for 10 min. The pink chromogen was measured at 532 nm in a microplate
reader (Synergy 2, BioTek, USA). The results were expressed as nmol/mg of protein.
-Plasma LPS levels
The principle of the LPS test is based on the fact that bacteria cause intravascular coagulation in the
American horseshoe crab, Limulus polyphemus. Endotoxin causes an opacity and gelation in Limulus
amebocyte lysate, which is based on an enzymatic reaction that cause a yellow color.
-Immunoglobulin A determination
Colonic samples were homogenized (glass/glass) at 4°C in four volumes of the same
homogenization buffer used for Western blot studies (see above). Homogenates were centrifuged (13,000g
for 20 min at 4°C), and supernatants were used for determinations according to the manufacturer’s
instructions. The results were expressed as ng/mg of protein.
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
Table S2. One way ANOVA analyses (F values and df) for all parameters. Control value: vehicle + no Stress.
Acute Stress
Chronic Stress
Parameter
Control value
F, df
Control value
F, Df
TNFα (pg/mg prot)
236.04 ±25.6
F= 5.32 df=15
127.31 ± 2.25
F= 8.51 df=25
IL1β (pg/mg prot)
358.93 ± 12.5
F= 4.09 df=15
566.85 ± 15.13
F= 4.51 df=25
WB NFκB (A.U)
0.87 ± 0.03
F= 11.32 df=15
0.51 ±0.02
F= 9.83 df=25
WB IκBα (A.U)
0.90 ± 0.06
F= 4.17 df=15
0.42 ± 0.01
F= 13.46 df=25
WB iNOS (A.U)
1.12 ± 0.14
F= 5.54 df=15
0.82 ± 0.03
F= 7.44 df=25
WB COX-2 (A.U)
0.50 ± 0.02
F= 4.88 df=15
0.35 ± 0.02
F= 4.47 df=25
WB mPGES-1 (A.U)
0.79 ± 0.03
F= 0.81 df=15
1.29 ± 0.04
F= 2.47 df=25
PGE2 (pg/mg prot)
76.67 ± 5.05
F= 4.71 df=15
12.16 ± 0.63
F= 3.53 df=25
MDA (nmol/mg prot)
0.19 ± 0.004
F= 6.95 df=15
0.24 ± 0.04
F= 5.41 df=24
NO2- (µmol/mg
1.57 ± 0.10
F= 9.26 df=15
1.29 ± 0.05
F= 1.84 df=24
WB TLR4 (A.U)
1.01 ± 0.02
F= 4.20 df=15
0.92 ± 0.06
F= 6.29 df=25
WB MyD88 (A.U)
1.12 ±0.04
F= 11.8 df=15
0.92 ± 0.05
F= 3.51 df=25
WB MD2 (A.U)
0.38 ± 0.05
F= 4.14 df=15
0.94 ± 0.04
F= 6.02 df=25
WB HSP60 (A.U)
0.91 ± 0.04
F= 2.17 df=15
0.79 ± 0.03
F= 1.98 df=25
WB HSP70 (A.U)
0.89 ± 0.05
F= 4.69 df=15
0.54 ± 0.02
F= 4.66 df=25
WB HMGB1 (A.U)
0.89 ± 0.03
F= 7.79 df=15
0.31 ± 0.03
F= 0.01 df=25
mRNA TNFα (A.U)
0.93 ± 0.02
F= 10.86 df=15
1.02 ± 0.03
F= 2.00 df=25
mRNA IL1β (A.U)
0.95 ± 0.02
F= 12.90 df=15
1.06 ± 0.09
F= 1.73 df=25
mRNA NFκB (A.U)
1.01 ± 0.03
F= 8.22 df=15
0.70 ± 0.05
F= 7.21 df=25
mRNA IκBα (A.U)
1.08 ± 0.04
F= 15.34 df=15
0.96 ± 0.04
F= 5.55 df=25
mRNA iNOS (A.U)
0.70 ± 0.07
F= 10.68 df=15
1.01 ± 0.06
F= 2.19 df=25
mRNA COX-2 (A.U)
0.91 ± 0.03
F= 1.97 df=15
1.09 ± 0.06
F= 4.13 df=25
mRNA mPGES-1 (A.U)
0.96 ± 0.03
F= 12.35 df=15
1.01 ± 0.02
F= 11.55 df=25
mRNA TLR4 (A.U)
0.86 ± 0.05
F= 14.46 df=15
1.18 ± 0.09
F= 4.33 df=25
mRNA MyD88 (A.U)
1.01 ± 0.04
F= 18.30 df=15
1.06 ± 0.02
F= 4.34 df=25
mRNA MD2 (A.U)
0.98 ± 0.02
F= 4.25 df=15
1.09 ± 0.07
F= 4.92 df=25
mRNA HSP60 (A.U)
0.93 ± 0.04
F= 0.68 df=15
1.09 ± 0.03
F= 6.30 df=25
mRNA HSP70 (A.U)
0.89 ± 0.04
F= 8.56 df=15
1.02 ± 0.03
F= 4.63 df=25
mRNA HMGB1 (A.U)
1.00 ± 0.02
F= 10.93 df=15
1.04 ± 0.03
F= 0.18 df=25
LPS (EU/ml plasma)
0.95 ± 0.09
F= 5.51 df=15
0.42 ± 0.02
F= 4.21 df=25
WB iNOS (intestine, A.U)
0.15 ± 0.01
F= 15.07 df=15
0.46 ± 0.03
F= 3.76 df=25
WB COX-2 (intestine, A.U)
0.48 ± 0.05
F= 4.054 df=15
0.91 ± 0.04
F= 0.19 df=25
IgA (ng/mg prot)
13.39 ± 0.5
F= 0.66 df=15
27.04 ± 3.40
F= 3.84 df=25
WB CCL28 (A.U)
0.73 ± 0.04
F= 1.75 df=15
0.54 ±0.03
F= 4.03 df=25
prot)
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
Table S3. 0.3mg/Kg and 1mg/Kg Paliperidone effects on LPS- induced TLR-4 inflammatory pathway
activation in rat prefrontal cortex. Control value: Vehicle + no injection
Paliperidone 0.3mg/Kg (Pali)
Parameter
% from control value
Control value
LPS
TNFα (pg/mg prot)
136.51 ± 3.93
180.11 ± 20.17
IL1β (pg/mg prot)
580,11 ± 19.26
NFκB (A.U)
F, Df
p value
106.04 ± 9.97
F=10.65 df=18
< 0.001
124.62 ± 1.78
99.99 ± 6.50
F=7.76 df=18
< 0.01
0.37 ± 0.01
213.13 ± 29.73
128.61 ± 12.00
F=8.70 df=19
< 0.01
IκBα (A.U)
0.40 ± 0.02
72.81 ± 9.65
119.02 ± 22.69
F=1.09 df=18
--
iNOS (A.U)
0.35 ± 0.01
285.60 ± 22.80
185.21 ± 26.74
F=18.08 df=19
< 0.01
COX-2 (A.U)
0.92 ± 0.13
165.62 ± 28.46
115.43 ± 7.43
F=3.52 df=19
--
mPGES-1 (A.U)
1.21 ± 0.03
122.51 ± 4.42
113.30 ± 3.80
F=5.81 df=18
--
PGE2 (pg/mg prot)
15.64 ± 1.26
174.83 ± 4.76
120.71 ± 19.63
F=16.24 df=18
< 0.01
MDA (nmol/mg prot)
0.13 ± 0.01
164.01 ± 4.97
120.04 ± 19.89
F=4.48 df=19
--
TLR4 (A.U)
0.92 ± 0.08
158.24 ± 10.93
125.40 ± 6.92
F=6.77 df=18
< 0.05
MyD88 (A.U)
0.89 ± 0.04
131.91 ± 6.22
97.89 ± 8.82
F=5.80 df=18
< 0.05
MD2 (A.U)
0.70 ± 0.02
129.20 ± 9.73
99.45 ± 4.02
F=7.40 df=18
< 0.01
Paliperidone 1mg/Kg (Pali)
Pali 0,3mg/kg+LPS
% from control value
Parameter
Control value
LPS
Pali 1mg/kg+LPS
F, Df
p value
TNFα (pg/mg prot)
136.51 ± 3.93
180.10 ± 20.17
103.01 ± 3.21
F= 13.38 df=18
< 0.001
IL1β (pg/mg prot)
580.11 ± 19.26
124.61 ± 1.78
100.82 ± 9.04
F=5.01 df=18
< 0.05
NFκB (A.U)
0.37 ± 0.01
213.14 ± 29.73
139.43 ± 16.53
F=7.24 df=19
< 0.05
IκBα (A.U)
0.41 ± 0.03
72.81 ± 9.65
136.70 ± 13.50
F=6.51 df=18
< 0.05
iNOS (A.U)
0.36 ± 0.01
285.60 ± 22.80
158.42 ± 30.91
F=17.58 df=19
< 0.01
COX-2 (A.U)
0.92 ± 0.13
165.62 ± 28.46
96.38 ± 3.52
F=3.98 df=19
< 0.05
mPGES-1 (A.U)
1.21 ± 0.03
122.51 ± 4.42
105.31 ± 6.42
F=4.97 df=18
< 0.05
PGE2 (pg/mg prot)
15.64 ± 1.26
174.83 ± 4.77
128.44 ± 9.10
F=15.26 df=18
< 0.01
MDA (nmol/mg prot)
0.13 ± 0.01
164.01 ± 4.97
103.93 ± 9.35
F=13.77 df=19
< 0.01
TLR4 (A.U)
0.92 ± 0.08
158.24 ± 10.93
122.41 ± 8.43
F=6.92 df=18
< 0.05
MyD88 (A.U)
0.89 ± 0.04
131.90 ± 6.22
103.42 ± 7.19
F=9.20 df=18
< 0.01
MD2 (A.U)
0.70 ± 0.02
129.22 ± 9.73
101.70 ± 4.92
F=5.77 df=18
< 0.01
MacDowell et al.
Paliperidone regulates Toll-like 4 receptor activation
Table S4.
Single Injection
Dual Injection
Parameter
Control value
p value*
Control value
p value*
LPS value
TNFα (pg/mg prot)
141.57±5.97
<0.01
151.43±7.35
<0.01
255.03±28.56
WB NFκB (A.U)
0.41±0.04
<0.05
0.43±0.04
<0.01
0.59±0.05
WB COX-2 (A.U)
1.±0.15
<0.05
1.06±0.10
<0.05
1.42±0.13
WB TLR4 (A.U)
0.81±0.08
<0.05
0.81±0.08
<0.05
1.28±0.13
* vs Veh+LPS group
SUPPLEMENTAL REFERENCES
-Herbert TB, Cohen S (1993): Stress and immunity in humans: a meta-analytic review. Psychosom Med
55:364–379.
-Radley JJ, Arias CM, Sawchenko PE (2006): Regional differentiation of the medial prefrontal cortex in
regulating adaptive responses to acute emotional stress. J Neurosci 26:12967–12976.
-Volk DW, Lewis DA (2010): Prefrontal cortical circuits in schizophrenia. Curr Top Behav Neurosci 4:485-508.
-Schreiber E, Matthias P, Muller MM, Schaffner W (1989): Rapid detection of octamer binding proteins with
‘mini-extracts’ prepared from a small number of cells. NucleicAcids Res 17: 6419.
-Green LC, Wagner DA, Glogowski J, Skipper PL, Wishnok JS, Tannenbaum SR (1982): Analysis of nitrate,
nitrite, and [15N]nitrate in biological fluids. Anal Biochem 126: 131-138.
-Das NP, Ratty AK (1987): Studies on the effects of the narcotic alkaloids, cocaine, morphine, and codeine
on nonenzymatic lipid peroxidation in rat brain mitochondria. Biochem Med Metab Biol 37: 258-264.
-Bradford MM (1976): A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Analytical Biochemistry 72: 248–254.