APPENDIX
Online Table 1. DNA segments inserted into pMIR-reporter assay
Gene
construct
sequence
THBS1
wild type
ACTAGTAAAAATGACAAAAGGTGAAACTTACATACAAATATTACCTCATTTGTTGTGTGACTGAGTACGCGT
THBS1
mutant
ACTAGTAAAAATGACAAAAGGTGAAACTTACATACAAATATGCTTGTATTTGTTGTGTGACTGAGTACGCGT
TGFBR1
wild type
ACTAGTATCTGCTCCTGGGTTTTAATTTGGGAGGTCAATTGTTCTACCTCACTGAGAGGGAACAGAAGGATATACGCGT
TGFBR1
mutant
ACTAGTATCTGCTCCTGGGTTTTAATTTGGGAGGTCAATTGTTAGCTTGAACTGAGAGGGAACAGAAGGATATACGCGT
SMAD2
wild type
ACTAGTAAGAAAATATATACCCAGTTGGTTTCTCTACCTCTTAAAAGCTTCCCATATATACCTTTAACGCGT
SMAD2
mutant
ACTAGTAAGAAAATATATACCCAGTTGGTTTCTTCGTTGACTAAAAGCTTCCCATATATACCTTTAACGCGT
3’SpeI site was marked in yellow; 5’MleI site was marked in green. Let-7g binding site was marked in red
1
Online Table 2. Serum let-7g levels and plasma concentrations of two biomarkers in patients of lacunar stroke (mean ± standard
deviation)
Subjects with low let-7g levels (N = 18) Subjects with high let-7g levels (N = 17) Student’s t test
–ΔΔCt
Serum let-7g ratio (2
)*
0.48 ± 0.27
Plasma PAI-1 levels (ng/ml)
5.61 ± 3.24
Plasma ADMA levels (umol/L) 0.60 ± 0.19
2.73 ± 1.36
3.70 ± 1.85
0.58 ± 0.21
p < 0.001
p = 0.04
p = 0.78
* The let-7g ratio of each stroke subject to the mean of all stroke subjects was calculated by 2-ΔΔCt where ΔΔCt was calculated by ΔCt of
individual subject minus the mean of ΔCt from all stroke patients (N = 60). ΔCt was referred to Ct let-7g – CtU6B
2
Online Fig 1a. Let-7g levels in HUVECs transfected with let-7g mimic or
inhibitor.
The relative let-7g levels were measured using qPCR in HUVECs transfected with (A)
different doses of let-7g mimic or (B) 5 nM let-7g inhibitor. Asterisk indicated
significant difference in intracellular let-7g levels between cells transfected with
let-7g mimic/inhibitor at the indicated doses and cells transfected with correspondent
control microRNA (Student’s t-test). ** p < 0.01, * p < 0.05.
3
Online Fig 2a. Concentrations of secreted MCP-1 and IL-6 in HUVECs
transfected with let-7g mimic or let-7g mimic plus TGF-1 10ng/ml.
4
Online Fig 3a. Concentrations of secreted MCP-1 and IL-6 in HUVECs
transfected with let-7g inhibitor, let-7g inhibitor plus SMAD2 siRNA, let-7g
inhibitor plus TGFBR1 siRNA, or let-7g inhibitor plus both SMAD2 and
TGFBR1 siRNAs.
Online Fig 4a. mRNA levels of PAI-1 and SMAD2 in the carotid arteries of
ApoE-KO mice were measured by qPCR.
Mice were injected with lentivirus carrying empty vector (empty), let-7g
over-expressing plasmids (let-7g exp) or let-7g sponge plasmids (let-7g sponge) per
week for the indicated period of times. HF denotes for high-fat diet containing 0.15%
cholesterol.
5
Online Fig 5a. Immunohistochemistry staining indicates PAI-1 (brown color,
upper panel) and pSMAD2 (brown color, lower panel) in endothelial cells of the
carotid arteries of ApoE-KO mice.
Mice were injected with lentivirus carrying empty vector or let-7g over-expressing
plasmids (let-7g exp plasmids) per week for 12 weeks. HF denotes for high-fat diet
containing 0.15% cholesterol.
6
Online Fig 6a. Network prediction for the let-7g effect on SIRT-1
The MetaCoreTM network prediction identified several possible pathways accounting
for the let-7g’s effect on SIRT-1.
7
Material and Methods
Target gene prediction. The TargetScan algorithm (1) was used to predict let-7g
target genes.
Construction of the 3’ untranslated region (UTR) reporter plasmids. The DNA
segment containing the predicted let-7g binding site at the 3’UTR of each target gene
and restriction enzyme sites (5’SpeI and 3’MluI) was synthesized (Online Table 1)
and cloned into the 3’ end of pMIR-REPORT luciferase vector (Ambion). For the
reporter assays, human embryonic kidney 293 cell line (HEK293) was transiently
transfected with reporter plasmids (700 ng) carrying wild-type or mutant sequence
and different doses of let-7g mimic or let-7g inhibitor using Lipofectamine 2000
(Invitrogen). pEGFP plasmids (100 ng) were co-transfected to serve as the internal
control. The luciferase activity was measured using the Luc-PairTM miR luciferase
assay kit (GeneCopoeia).
Material. Human umbilical endothelial cells (HUVECs, C-003-5C) were purchased
from Invitrogen (Grand Island, NY). HEK293 and human acute monocytic leukemia
cell line (THP-1) were purchased from ATCC (Manassas, VA). The culture media
including medium 200 (M200), low serum growth supplement (LSGS) and other cell
culture-related reagents were purchased from Cascade Biologics (Portland, OR).
8
Ox-LDL was purchased from Biomedical Technologies (Stoughton, MA). Primary
antibodies for western blot were purchased from Cell Signaling (Danvers, MA).
Enhanced chemiluminescence (ECL) solution was purchased from Millipore
(Billerica, MA). HiPerFect transfection reagent was purchased from Qiagen (Valencia,
CA). TRIzol® reagent, Lipofectamine 2000, and secondary antibodies were purchased
from Invitrogen. The kits for TaqMan microRNA assay (let-7g and RNA-U6B) and
TaqMan gene expression assay (THBS1, TGFBR1, SMAD2, SIRT-1, and GAPDH)
were purchased from Applied Biosystems (Foster City, CA). mirVana® miRNA let-7g
mimic, inhibitor and corresponding negative controls were purchased from Applied
Biosystems. The kit for Luc-PairTM miR luciferase assay was purchased from
GeneCopoeia (Rockville, MD). The material for Matrigel assay was purchased from
BD biosciences (Franklin Lakes, NJ). The kits for enzyme-linked immunosorbent
assay (ELISA) for VCAM-1, IL-6 and PAI-1 were purchased from R & D
(Minneapolis, MN). The ELISA kit for MCP-1 was purchased from BD Biosciences,
and for ADMA was purchased from DLD (diagnostika GmbH, Germany). Lentiviral
expression vector pCDH-CMV-MCS-EF1-GreenPuro was purchased from SBI
(Mountain View, CA).
Cell culture. HUVECs were grown in culture medium containing M200, LSGS, 100
9
IU/ml penicillin, and 0.1 mg/ml streptomycin. Passages 4 to 6 were used for
experiments. Cell cultures were incubated at 37 ◦C in a humidified atmosphere
containing 5% CO2 and 95% air for 24 hours to induce quiescence.
Quantitative real-time PCR (qPCR). Extraction of total RNA was carried out using
TRIzol® reagents, while reverse transcription was performed by using Superscript® III
first-strand synthesis SuperMix (Invitrogen). qPCR was performed by using an ABI
7900HT Fast Real-Time PCR system with TaqMan gene expression assays (Applied
Biosystems). The expression level of each target gene was calculated by using the
difference in the threshold cycle method (ΔCt) with normalization to the
housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Let-7g can be partitioned from the extracted total RNA by reverse transcription
using TaqMan microRNA reverse transcriptase kit (Applied Biosystems). qPCR was
then performed using TaqMan microRNA assays (Applied Biosystems), and the
expression levels were calculated by using ΔCt method with normalization to
RNA-U6B.
Western blot analysis. Cells were harvested by cell lysis buffer (Cell signaling)
containing a protease inhibitor and phosphatase inhibitor cocktail (Calbiochem).
10
Protein lysates (40g) were denatured and loaded onto a 10% SDS polyacrylamide
gel. The separated proteins were then transferred onto a PVDF membrane (Millipore).
The membrane was incubated overnight at 4°C in 2% BSA/PBST containing the
primary antibodies. Primary antibodies against total SMAD2 (1:1000), pSMAD2
(phosphorylation site at Ser465/467, 1:1000), SIRT-1 (1:1000), and GAPDH (1:5000)
were used (Cell signaling). The membrane was incubated with the secondary antibody
conjugated to horseradish peroxidase. The ECL non-radioactive detection system was
used to detect the antibody–protein complexes by LAS-3000 imaging system
(Fujifilm, Tokyo, Japan). Blot intensity was quantitatively measured by ImageJ
software (NIH).
Monocyte adhesion assay. The monocyte adhesion assay was carried out using the
THP-1 cells as described previously (2). After being transfected with microRNA for
24 hours, HUVECs were plated onto 96-well fluorescence plates (353948; BD).
HUVECs were then treated with 40 ug/ml ox-LDL for 5 hours. THP-1 cells were
washed with serum-free RPMI 1640 medium and suspended in medium with 5 μM
Calcein AM (C3100MP, Invitrogen) for labeling. HUVECs were then incubated with
Calcein AM–labeled THP-1 cells for 1 hour. Non-adherent THP-1 cells were removed
by washing with warm RPMI 1640 medium gently. Fluorescence was measured by
11
using a fluorescence plate reader at 485 nm excitation.
Matrigel assay for angiogenesis. Matrigels (BD) were thawed and placed at 37℃ for
one hour before use. After being transfected with miR for 24 hours, HUVECs were
seeded in matrigel-coated 24-well plate at a density of 70000 cells per well. After
incubation for five hours, phase-contrast images (25x and 50x magnifications) were
taken using a Zeiss Axiovert 200M microscopy (Carl Zeiss, Germany). Tubule
formation was measured by counting the number of branches from randomly taken
images per experimental condition.
ELISA and Griess method for nitrate concentration. HUVECs were transfected
with 5 nM mimic control or let-7g mimic. The supernatant of culture medium was
collected at an interval of 0, 24, 48 and 72 hours post-transfection. The concentrations
of VCAM-1, MCP-1, IL-6 and PAI-1 were determined by ELISA as the
manufactures’ instruction using an EnSpireTM Multimode Plate Reader (PerkinElmer).
eNOS activity was measured by Griess method as described previously (3). The
Griess reagent (100ul) containing 0.1% N-(1-napththyl)ethylenediamine (NED), 1%
sulfanilamide and 5% phosphoric acid (H3PO4) was mixed with the same volume of
supernatant (100 ul) from culture medium. The supernatant of culture medium was
12
collected at an interval of 0, 24, 48 and 72 hours post-transfection with microRNAs.
After being incubated in dark for 10 minutes at 37 °C, the density of the mixture of
reagent and supernatant was measured at 540 nm using an EnSpireTM Multimode
Plate Reader. The concentration of nitrate in the sample was determined using a
calibration curve generated with standard NaNO2 solutions by a serial dilution with
same volume of 0.1% NED in dH2O. The amount of total protein in the cell lysate
was measured by Bio-Rad protein assay (Hercules, CA) to adjust the nitrate
concentration.

-Gal staining for senescence. After being transfected with microRNA for 24 hours,
HUVECs were treated with 10 mM of nicotinamide (NA). The senescent status of
HUVECs was assessed by the cellular senescence assay kit (Millipore) as
manufacture’s instruction. Briefly, cells were incubated with the senescence Gal
detection solution for 16 hours at 37°C. The reaction was stopped by removing the
senescence Gal detection solution and the stained cells were washed with PBS. The
percentage of -Gal stained cells was counted microscopically from randomly
acquired images per experiment condition.
Immuno-fluorescence stain. HUVECs were fixed with 4% paraformaldehyde and
13
permeabilized with 0.5% Triton X-100 (GIBCO-BRL). The cells were then incubated
with anti–total SMAD2 antibody (1:500; Cell signaling) and AlexFluor 488 goat
anti-rabbit antibody (1:500; Invitrogen). The nuclei were counterstained with
4′6-diamidino-2-phenylinodole dihydrochloride (DAPI 1:1000; Invitrogen).
Fluorescence was detected by a FluoviewTM FV1000 confocal microscopy (Olympus).
Stains for the carotid artery. After mice were sacrificed, the carotid arteries were
removed and embedded in Sakura Tissue-Tek® O.C.T compound. The tissue was cut
transversally into 8-μm serial sections and stained with mouse anti-PAI-1 antibody (1:
100 dilution; Novus Biologicals) or anti-pSMAD2 antibody (1:2000 dilution;
Millipore) using the IHC Select™ kit (Millipore). Quantitative analysis of staining
intensities was performed by TissueFAXS system (TissueGnostics GmbH, Australia).
For immunofluorescence stain of macrophage, carotid arteries were incubated with
anti-Mac-3 antibody (1:100; Millipore) and Dylight 649 conjugated goat anti-rat
antibody (1:200; Rockland). Fluorescence was detected with a Leica DMI6000B
microscopy (Leica Microsystems, Bannockburn, IL, USA).
References
1.
Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by
14
adenosines, indicates that thousands of human genes are microRNA targets.
Cell 2005;120:15-20.
2.
Sun X, Icli B, Wara AK, et al. MicroRNA-181b regulates
NF-kappaB-mediated vascular inflammation. J Clin Invest 2012;122:1973-90.
3.
Privat C, Lantoine F, Bedioui F, Millanvoye van Brussel E, Devynck J,
Devynck MA. Nitric oxide production by endothelial cells: comparison of
three methods of quantification. Life Sci 1997;61:1193-202.
15