DNA Structure, Transcription, Translation

advertisement
DNA Structure, Transcription, Translation
1. In which of the following pairs of processes does the DNA unzip?
A. Transcription and Translation
B. Transcription and Replication
C. Replication and Translation
2. Which DNA strand would pair to the following DNA strand? A-T-G-C-T-A
A. T-A-C-G-A-T
B. A-T-G-C-T-A
C. U-A-C-G-A-U
D. A-U-G-C-U-A
3. Which of the following mRNA codons might cause a growing Amino Acid chain to
break away from the ribosome?
A. UAU
B. GAU
C. UAA
D. AUG
4. Which of the following base pairs would never be found in a cell?
A. Adenine-Thymine
B. Cytosine-Guanine
C. Thymine-Uracil
D. Adenine-Uracil
5. A protein is assembled amino acid-by-amino acid during the process of
A. Replication
B. Translation
C. Transcription
6. The end product of transcription is
A. 1 copy of DNA
B. 1 strand of mRNA
C. 1 amino acid chain
7. The enzyme that allows replication to occur is called
A. DNA Polymerase
B. RNA Polymerase
8. Molecules of........bring amino acids to the..........for assembly into proteins
A. tRNA, Ribosome
B. rRNA, Ribosome
C. tRNA, Nucleus
D. rRNA, Nucleus
9. When I built my shed this summer, my friend Jon drew the plans on a napkin, drove
his truck to my house with the supplies, and helped me put it together. What represents
the rRNA?
A. The napkin
B. His truck
C. Jon
10. When I built my shed this summer, my friend Jon drew the plans on a napkin,
drove his truck to my house with the supplies, and helped me put it together. What
represents the mRNA?
A. The napkin
B. His truck
C. Jon
11. When I built my shed this summer, my friend Jon drew the plans on a napkin,
drove his truck to my house with the supplies, and helped me put it together. What
represents the tRNA?
A. The napkin
B. His truck
C. Jon
12. What is NOT a primary difference of RNA compared to DNA (which statement is
false)?
A. RNA is single-stranded, DNA is double
B. RNA is kept in the nucleus, DNA can leave
C. RNA uses Uracil, DNA uses Thymine
D. RNA is made one gene at a time, DNA can contain thousands of genes
13. What percent of our DNA contains genes?
A. 1%
B. 10%
C. 50%
D. 100%
14. Protein synthesis first requires ____, to make_____ for use in combining amino
acids in the process of_______ that occurs with the help of__________
A. translation, DNA, transcription, mRNA
B. transcrition, mRNA, translation, DNA
C. replication, rRNA, transcription, mRNA
D. transcription, mRNA, translation, tRNA
15. When DNA is replicated
A. a molecule of mRNA is constructed using DNA as a template
B. each strand of DNA serves as a template for building a new partner strand
C. Replication begins at one end of the chromosome and continues to the other end
16. Which of the following statements regarding transcription and translation is true?
A. mRNA includes the bases A, C, G, and U
B. The mRNA transcript may have sections on each end that are "ignored" during
translation
C. A codon consists of a sequence of three bases
D. A-C are all true
E. A-C are all false
17. What is the Amino Acid sequence for the following mRNA strand?
GAAAUGCCCGAGUACGCAGGAUGACCA
A.
B.
C.
D.
Glu-Met-Pro-Glu-Tyr-Ala-Gly-Pro
Met-Pro-Glu-Tyr-Ala-Gly
Met-Pro-Glu-Tyr-Ala-Gly-Pro
Glu-Met-Pro-Glu-Tyr-Ala-Gly
Download