S1 Text
GENERATION OF OED5 AND OEE CELLS
Mouse ES D3 cells infected by the viral produced from plasmid, pCS-UBC-Dusp5, to
produce cells that over-expressing the Dusp5 protein (OED5 cells), and mES D3 cells
over-expressing the EGFP protein (OEE cells) were obtained by the same strategy, for
use as a control. In order to determine whether the exogenous Dusp5 mRNA was
transcribed, the following pair of PCR primers was designed: a primer with mDUSP5F5
located at the 3’ terminus of Dusp5 and a primer with PCSR located in the 3’ untranslated
region (UTR) derived from the plasmid (Table 1). Following transfection, OED5, OEE and
wild type D3 cells (WT cells) were passaged for two generations before harvesting to
eliminate the plasmid and viral contaminants. The PCR amplified band only appeared in
the OED5 cell sample (Fig. S1A), suggesting that exogenous Dusp5 mRNA was
transcribed only in OED5 cells. To assess this result quantitatively, qRT-PCR analysis was
performed and the results demonstrated that the Dusp5 expression level in OED5 cells
was up-regulated almost five-fold compared with OEE and WT cells (Fig. S1B). This result
was confirmed by Western blot analysis with a Dusp5 specific antibody (Figs S1C and D).
GENERATION OF DUSP5 KNOCKDOWN CELLS
For the knockdown of Dusp5, seven small hairpin RNAs (shRNAs) with stem sequences
complementary to mouse Dusp5 mRNA were selected. However, of the seven, only
shDusp5Mu1 (Target Sequence: GCTGACATTAGCTCCCACTTT) showed efficient
knockdown of the target gene. Mouse ES cells infected with shDusp5Mu1 (SHD5-pool
cells) showed a twofold reduction in Dusp5 expression compared to WT cells and control
cells (scramble shRNA-treated D3 cells (Scr cells)) (Fig. S2A). Western blot analysis with
a Dusp5 specific antibody revealed weaker immunoblot signals in SHD5-pool cells
demonstrating a decrease in the amount of Dusp5 protein (Fig. S2B). Analysis of the two
isolated clones obtained from Dusp5 knockdown cells (SHD5-e5, SHD5-g2) yielded
similar results (Fig. S2A-B).
Fig S1. Over-expression of Dusp5 in mES cells.
A: RT-PCR analysis of exogenous Dusp5 expression in WT, OEE and OED5 cells. Gapdh
was amplified as the internal control. Mock: no template control. B: Over-expression of
Dusp5 in WT, OEE, OED5 cells were analyzed by qRT-PCR (n=4). Gene expression was
normalized against a ß-actin internal control. Error bar represents the means ±S.D. from
four independent experiments. **P<0.01. C: Western blot analysis of WT, OEE and OED5
cells with an anti-Dusp5 antibody and an anti-ß-actin antibody. Immunoblot signals are
indicated by arrows. D: Quantitation of the Dusp5 band intensity in the immunoblot in C
was conducted using ImageJ 1.44 program (National Institute of Mental Health, Bethesda,
Maryland, USA). The densitometric intensity of the Dusp5 band was normalized against
that of ß-actin, and corresponding values of OEE and OED5 were expressed as fold
numbers of that of WT. WT: wild type mES D3 cells; OEE: mES D3 cells over-expressing
the EGFP protein; OED5: mES D3 cells over-expressing the Dusp5 protein.
Fig S2. Dusp5 knockdown in mES cells.
A: Knockdown performance of shDUSP5Mu1 in mES cells by qRT-PCR (n=4). Gene
expression was normalized against a ß-actin internal control. Error bar represents the
means ±S.D. from four independent experiments. *P<0.05. B: Western blot analysis of
mES cells with an anti-DUSP5 antibody and an anti-Gapdh antibody. Immunoblot signals
are indicated by arrows. WT: wild type mES D3 cells; Scr: scramble shRNA-treated mES
D3 cells; pool: SHD5-pool cells; g2: SHD5-g2 cells; e5: SHD5-e5 cells.
Fig S3. Dusp5 expression was induced by bFGF treatment.
Mouse ES cells were plated on gelatin-coated tissue culture plates over night, before
addition of bFGF (10 ng/ml). Cells were then harvested for RNA isolation, and followed by
qRT-PCR analysis (n=4). Gene expression was normalized against a ß-actin internal
control. Error bar represents the means ±S.D. from four independent experiments.
*P<0.01.
Fig S4. The role of Dusp5 in mES pluripotency and differentiation
Undifferentiated mES cells employed transcription factors, such as Nanog and Oct4, and
various cytokines such as LIF, to maintain the pluripotent state. The commitment of mES
cells to differentiation is induced by cell signaling molecules, such as phospho-Erk. Dusp5
counteracts differentiation by inhibiting FGF/Erk signaling. During EB development,
Dusp5 may be important for endoderm and mesoderm differentiation, via the precise
control of Erk signaling.