Supplementary Table 1. Ph1 region genes, their homologies to genes of known
function and gene expression in different tissues.

gene expression
w
weak gene expression
x
no gene expression
-
not tested
*
For all genes there was a transcript in both Chinese Spring and ph1b, except in
cdc2-4, which is only present on the B genome.
Genes within the subtelomeric insertion region are shown in bold.
Supplementary Table 2. Sequenced BACs, their EMBL database accession number,
gene content, numbers of sequence contigs per BAC and sequence coverage.
Wheat BACs are shown in ascending numerical order.
Supplementary Table 3. Wheat Ph1 region genes and their orthologues in rice
chromosomes 9 and 8.
Genes within the subtelomeric insertion region are shown in bold. Locus identifiers
from TIGR version 3 annotation except for hypothetical 4 which has an EMBL
accession.
Supplementary Figure 1. Mapping of the Ph1 deletion breakpoints in relation to
rice chromosome 9.
Black circles on solid horizontal lines represent presence of rice marker on
chromosome 5B of the deletion line. White circles represent absence of marker. Red
dashed lines represent breakpoint regions. Distances in the rice genome are indicated
in kb. Deletion lines labelled Ph1 +ve exhibit low chromosome pairing in wheat-rye
F1 hybrids. Those labelled Ph1 -ve show high chromosome pairing.
Supplementary Figure 2. Schematic relationship of the conserved genes within the
Ph1 deletion region on wheat chromosomes 5B, A and D, rice chromosomes 9 and 8
and Brachypodium regions 1 and 2.
Horizontal lines represent parts of chromosomes. Black circles indicate marker
presence and white circles marker absence. Yellow region on wheat chromosome 5B
represents subtelomeric insertion from chromosome 3A. Red diamonds denote
tandem repeats.
Supplementary Figure 3. Example of PCR products amplified from cDNA and
genomic DNA templates using hyp1 intron-flanking primers.
cDNAs were from leaf, flower and seed. CS = Chinese Spring euploid.
Supplementary Figure 4. Hybridisation of the Ph1 tandem repeat onto wheat
aneuploid lines, showing locations on chromosomes 5B and 3B.
Genomic DNA was digested with HindIII, Southern blotted and hybridised with the
Ph1 tandem repeat. Bands were mapped by their absence in nullisomic-tetrasomic
lines when compared with euploid lines.
Supplementary Figure 5. Localisation of the 5B tandem repeat to mitotic and
meiotic chromosomes by in situ hybridisation.
Telomeric repeat probe labelled red; Ph1 repeat probe labelled green. (a) Chinese
Spring root tip metaphase spread of DAPI-stained chromosomes. (b)-(f) Meiocytes.
(b) Chinese Spring before pairing. (c) Chinese Spring telomere bouquet; The two
3BL subtelomeric repeat sites are paired; the two 5B repeat sites are unpaired at this
stage (d) Chinese Spring after pairing of the 5B and 3B loci. (e) ph1b before pairing;
only the 3B subtelomeric repeat is present. (f) ph1b telomere bouquet; the 3B
subtelomeric repeats are paired.
Supplementary Figure 6. Comparative HindIII digests of hexaploid and tetraploid
wheat BACs showing tandem repeat bands. Hex = hexaploid wheat BAC; Tet =
tetraploid wheat BAC.
Band sizes are shown in kb.
Supplementary Figure 7. Cdc2-4B specific PCR assay performed on wheat species
containing the B, G or S genome.
Supplementary Figure 8. Mutiplex PCR assay for the newly defined Ph1 locus. The
locations of elp1 (primer sequences are; elp1F CGCAAGACAAAAGCCAAAGC and
elp1R AAGCTGCTCAATGTACAGTGTC ) and mads (primer sequences are; madsF
CTCCGCGTGCTTTTCTGC and madsR GTGGCAACTGCCGGAAGA) are shown
in Fig. 1. The psr128 assay has been published previously 15. GMW337 is a publicly
available SSR marker (primer sequences are; GMW337F GCTAACTGGCCTTTGCC
and GMW337R CCTCTTCCTCCCTCACTTAGC). 1625E21_Bspec1 (primer
sequences are; 1625E21_Bspec1 F TCAACCTAGAACTACGCG and
1625E21_Bspec1 R ATCTGTTCAATGGTGCGG) and 1051I3_Bspec1 (primer
sequences are; 1051I3_Bspec1 F GTGTCTAGACCTCTTCTG and 1051I3_Bspec1 R
CAACAGTGGGCAGAAACG ) are genome specific PCR products designed from
sequence of BACs 1625E21 and 1051I3 shown in Fig. 1.