PV92 in silico PCR results (fields highlighted in yellow are to be completed by student)

Forward primer (FP; 25 bp): 5’-GGATCTCAGGGTGGGTGGCAATGCT-3’

Reverse primer (RP; 26 bp): 5’-GAAAGGCAAGCTACCAGAAGCCCCAA-3’

The GI number for this hit is: 6721141; the entry was added in the YEAR 2000

DEFINITION/TITLE: Homo sapiens chromosome 16 clone RP11-131F3, complete sequence

What chromosome is this sequence located on? Chromosome 16

From what position # to what position # does the FP match the hit? From 1) 56722 to 2) 56746

From what position # to what position # does the RP match the hit? From 3) 57137 to 4) 57112

What is the lowest pos. # among the values for 1) through 4)? Lowest 5) 56722

What is the highest pos. # among the values for 1) through 4)? Highest 6) 57137

How long a nucleotide stretch do these two positions span? 416 bp

This is the length of the amplicon that could be amplified in a PCR reaction using above primers on
human DNA. Does the GenBank entry contain the ancestral form of the PV92-locus or the derived
form PV92::Alu? The ancestral form prior to the Alu-insertion

Extract from the DNA sequence the DNA stretch from the lowest to the highest nucleotide pos. 5)
though 6) above. Paste the sequence into the text box below.
7)

5’-ggatctcagggtgggtggcaatgctccttcactgaaatctgcagttatctctac
ccaaggcttacagtaaattttttgcaaattagaaagccctttgctctctcagtaaac
cctggctttcaagatttttgttttagtaaagtctttagactaaatgttgaatctttc
actctctttgctcctaatcatctctaagacagcaaatgcctctagcaaaaaagagga
gacgtcaactgggaaaatttgaagagaaagtcacacagatacatttcagtaaggttg
tctctgttacttgaggcttacaagaaggaaagaa|ttccctctctaaacacactcta
aacacacaggagttgagaacggggagatttattccagaaccccttctgtgcgttggg
gcttctggtagcttgcctttc-3’
Find out where in the sequence the primers would anneal. Reflect on the difference between using
primer sequences in a BLAST search and using primers in a true PCR reaction.
______The difference between a search and a PCR reaction is that in a PCR reaction primers
anneal to their complementary sequences and BLAST searches are designed to identify
identical sequences. FP matches the first 25 nucleotides of the sequence. The last 26
nucleotides of the amplicon match the (RP/reverse RP/complementary RP/)reverse
complementary RP.________
Identifying PV92 in the human genome

Complete this sentence by strikingg out anything that does NOT describe the position of PV92 in the
human genome: PV92 is located on the short/long arm of chromosome ______ close to/far
away/halfway between the centromer and the telomer.

What structure is PV92 situated in? What does the blue line represent? PV92 is located in a gene.

What is the name of the structure? What is its function?
__CDH13, a gene for a cell adhesion protein in heart muscle.___________________________
____________________________________________________________________________
____________________________________________________________________________

What sub-structure is PV92 located in?
______PV92 is located in an intron of the CDH13. Therefore, the eventual insertion of an Aluelement occurred within a non-coding part of the gene which explains why people homozygous
for PV92::Alu do not___ suffer any disadvantages over people who are heterozygous or homozygous for the ancestral allele.____________________________________________________
____________________________________________________________________________
PV92 polymorphisms in databases worldwide

Performing a BLAST search with the 416 bp PV92 amplicon sequence under 7) above yielded the
following results with E-Values smaller than 0.1:
Gi-number
TITLE/ DEFINITION
YEAR
gi: 6721141
gi: 11095297
Homo sapiens chromosome 16 clone RP11-131F3, complete sequence
Recent insertion of an Alu element within a polymorphic humanspecific Alu insertion
A transpositionally and transcriptionally competent Alu
subfamily
2000
2001
Which
state?
ancestral
derived2
1993
derived
gi: 178509

Draw a figure illustrating the relationships among the three forms of the PV92 locus:

Analyzing the three hits indicate in the amplicon sequence under 7) above the primary Alu-insertion
site.