Supplementary methods
iPS maintenance and neuronal differentiation.
iPS cells were grown in matrigel-coated (BD Biosciences) cell culture plates in mTeSR1
medium (Stem Cell Technologies) supplemented with 50U/ml penicillin and 50mg/ml
streptomycin and 1 ug/ml Puromycin. Cells were passed once every week using 1mg/ml
collagenase type IV (Gibco). Neuronal differentiation was performed using the
previously published protocol with minor modifications . Briefly, cells were dissociated
with 1X Accutase (Gibco) for 10 minutes at 37°C and Embryoid Bodies (EBs) were
generated using AggreWell Plates according to manufacturer instructions (Stem Cell
Technologies). EBs were grown in suspension cultures for 2 days in hES medium
(KnockOut DMEM supplemented with 15% KnockOut Serum Replacement, 50U/ml
penicillin, 50mg/ml streptomycin, 2mM L-Glutamine, 0.1 mM non essential amino acids,
and 0.5mM β-mercaptoethanol). EBs were differentiated for an additional 2 days in
Neuronal Induction Medium (DMEM/F12 supplemented with 1X N2, 0.1 mM nonessential aminoacids and 2 μg/mL Heparin). At day 6 cells were seeded on laminincoated plates (20ug/ml-Roche); Neuronal Induction Medium was changed every other
day and cells were maintained until day 18. In this period neural precursor cells (NPCs)
organized in neural rosettes emerged. At day 18, rosettes were manually lifted and
allowed to grow as floating neurospheres for three days in neuronal medium plus 1X B27
supplement and then plated onto poly-N-Ornithine and Laminin-coated plates for
terminal differentiation .
Expression profiling.
RNA isolation: Total RNA was extracted with RNeasy mini kit (Qiagen) according to the
manufacturer’s protocol. Prior to array hybridization, RNA quality and quantity were
assessed with the RNA 6000 Nano Assay using 2100 Bioanalyzer (Agilent
Technologies). The exclusive expression of only one CDKL5 allele in clones from the
female patient was confirmed by direct sequencing of RT-PCR products spanning the
region containing the mutation. To confirm monoallelic CDKL5 expression, consistent
inactivation of the same X chromosome in all cells of the selected clones was verified by
sizing of the polymorphic trinucleotide repeat of the androgen receptor gene, as
previously reported .
Microarray analysis. Five hundred ng of total RNA from control and mutant samples was
used to prepare amplified and labeled cRNA using Quick-Amp Labeling Kit (Agilent).
Control and mutated samples were labelled with Cy3-dCTP and Cy5-dCTP respectively.
For each clone, four technical replicates were performed to control technical bias.
Following purification with Qiagen RNeasy kit (Qiagen), cRNA was quantified using
NanoDrop ND-1000 UV-VIS Spectrophotometer in order to determine the yield and
specific activity of each reaction. For each replicate 825 ng of labeled control cRNA was
combined with 825 ng of labelled mutated cRNA. The combined reactions were then
applied to cRNA microarrays (Agilent Whole Human Genome 4X44K). Hybridization
was carried out at 65°C for 17 hr in a hybridization oven. Blocking agent was added
according to the protocol. Following hybridization, microarrays were washed and
scanned with an Agilent DNA microarray scanner (G2505B).
Microarray raw data were analysed by Agilent Feature Extraction Software v9.5 for
quality assessment. The data were then imported into Gene Spring GX software v11.5 for
processing and analysis. Data for each mutant/control pair were analyzed independently.
Data were pre-processed with the “baseline transformation to median of all samples” step
for normalization across technical replicates. Moreover, in order to remove unreliable
entities, only probes flagged as “detected” (probe signal significantly above background)
in at least 3 out of 4 technical replicates were considered for further analysis.
Significantly modulated genes were defined as those with absolute fold change (FC) >
1.5. Statistical significance of differences was evaluated by the non-parametric MannWhitney test; a p<0.05 was considered significant. The Benjamini and Hochberg false
discovery rate (FDR) correction was used to estimate the false discovery rate.
Real Time qRT-PCR: Ten micrograms of total RNA was reverse transcribed with high
capacity
cDNA
reverse
transcription
kit
(Applied
Biosystem)
according
to
manufacturer’s instructions. PCR was carried out in single-plex reactions in a 96-well
optical plate with TaqMan Universal PCR Master Mix (Applied Biosystem) on ABI
Prism 7700 Sequence Detection System (Applied Biosystems). Experiments were
performed in triplicate in a final volume of 50 µl. For iPSCs 0.5 μg of cDNA were used
while for neuronal precursors and neurons we used 100 ng of cDNA. Standard thermal
cycling conditions were employed (Applied Biosytems): 2 minutes at 50 °C and 10
minutes at 95 °C followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Results
were analysed using the comparative Ct method.
Immunoblotting: Neurons were lysed using an insulin needle in RIPA Buffer (1% NP-40,
0,5% Na-deoxycholate, 0,1% SDS, 2 mM EDTA, 150 mM NaCl, 50mM NaF, 50 mM
Tris-HCl, pH 7.4, and protease inhibitors). Samples were cleared from non-solubilized
material (200,000 x g for 20 min) before being used for SDS-PAGE electrophoresis.
Proteins were separated by SDS-PAGE, transferred over-night onto polyvinyldifluoride
(PVDF) membranes, incubated with primary antibodies for 1 h, washed three times for
30 minutes each with washing buffer (Tris-buffered saline with 0,05% Tween-20),
incubated with HRP-protein A (1:10,000 in 5% milk) for 1 h, and washed for 2 h before
detecting ECL, ECL plus or Femto signals by film. Multiple exposures with increasing
time periods were obtained to ensure that signals were in the linear range. Anti-GluD1
antibody had originally been developed by Robert Wenthold at NIH 40. It has been raised
against a specific epitope of the GluD1 protein, to distinguish it from GluD2, which has
otherwise 56% identity. The antiserum was used at 1: 100 dilution. Anti-alpha Tubulin
(Santa-Cruz biotechnology.;sc-32293, lot#B1010) was used at 1:10,000. Protein A-horse
radish peroxidase (HRP) conjugated was from GE Healthcare (# NA9120V). Goat antimouse-HRP conjugated was from Biorad (#172-1011). Both were used at 1:10,000.
Immunoprecipitation (IP): Immunoprecipitations were performed incubating 50-60 mg of
totalbrain lysate onto 30 ml of Protein A-covered beads (GE Healthcare) for 4 hours at
+4°C with the addition of the anti-GluD1 antibody (2 mg). An equivalent amount of nonspecific rabbit IgG was used in the IgG control. After the IP, the beads were washed three
times for five minutes in washing buffer (0.5% Glycerol, 0.05% TX100, 150 mM NaCl,
10 mM EDTA, 10 mM EGTA, 10 mM Tris-HCl, pH 7.4). Proteins were then used for
SDS-PAGE and Western Blot analysis.
Chromatin immunoprecipitation (ChIP): SHSY-5Y neurons were differentiated by 48h
treatment with phorbal 12-myristate 13-acetate (PMA) then crosslinked by addition of
formaldehyde to a final concentration of 1.0%. Cells were then washed with 1XPBS then
harvested by centrifugation prior to fragmentation by restriction enzyme digest. For
Chromatin Immunoprecipitation (ChIP), fragmented chromatin was immunoprecipitated
with a custom-amino terminal MeCP2 antibody produced by Aves Labs (Tigard, Oregon,
USA). ChIP isolated chromatin was then subjected to quantitative PCR with primers
targeting the GRID1 promoter region (GRID1_For: ATGAGCCAGCAAGGTGACTT;
GRID1_Rev: GGGTGGGTCAGGTTTCACTA). PCR was performed in triplicate.
Statistical evaluation was performed using a two tailed t-test, assuming unequal variance.
Supplementary figure 1
-III-Tubulin staining of cultures sorted with the anti-CD24 micro-beads. Sorted cells
were plated and stained 48 hours later. Immunostaining confirms the neuronal identity of
the sorted cells.