Supplemental methods
Maternal behavior test
Maternal behavior tests were performed in the postpartum female rats in the control
and different morphine-exposed groups as described by a recent study (Zhao and Li,
2012). Maternal behavior test was tested on postpartum days 6-8 and each test session
lasted 20 min. In brief, the test was initiated by taking the 8 pups away from the
mother and destroying the nest. After 10 seconds, the pups were placed in the corner
of the cage diagonal to the nest site or dam sleeping corner. Pup retrieval (the subject
picking up a pup in her mouth and carried it back to the nest site), pup licking (a
female rat placing its tongue on the anogenital area and the rest of a pups body), nest
building (a rat picking up nesting material in her mouth and transporting it back to the
nest site or pushing the material with her forepaws toward the nest site) and crouching
(a rat positioning herself over pups with legs splayed to accommodate the pups,
including hover, high and low crouching over pups) were recorded by an observer
blind to the experimental groups.
Morris water maze test
Morris water maze test was undertaken as described previously (Li et al., 2008). The
maze was placed in a room with extra-maze visual cues. It consisted of a circular
water tank (diameter, 210 cm; height, 60 cm) filled with water (depth, 36 cm) at
25±1.0 oC. The water was made opaque by covering its surface with white floating
resin beads. The tank was divided into 4 virtual quadrants. A hidden escape platform
(11 cm×11 cm) was submerged 2 cm below the water surface in the middle of one of
the quadrants (training quadrant), and it was not visible at water level. The hidden
platform was maintained in a fixed position throughout the training trial, while it was
removed from its position for the probe trial.
Each rat was made to undergo 8 training sessions per day (4 trials in the morning and
4 in the afternoon) for 5 d (40 trials in total), with an interval of 5 min between the
sessions. The order of entry into each of the 4 individual quadrants was
pseudo-randomized. In each trial, the rat was allowed to swim until it found the
hidden platform; thereafter, if the rat was successful, it was allowed to rest on the
platform for 10 s. If it was unsuccessful after 60 s, it was placed on the platform and
allowed a 10 s rest period. The time taken to find the platform was recorded.
On day 1 (for the memory activity test) after the training trial was completed, a probe
trial was conducted, wherein the platform was removed from the pool to measure any
spatial bias the rat may have developed toward the original platform location. The rat
was placed in the water at the quadrant between the target (platform) and opposite,
and allowed to swim freely for 60 s. The amount of time spent in the quadrant where
the platform had been previously placed (target) in relation to the time spent in the
other 3 quadrants was an indication of the memory capacity of the rats. The
swimming paths followed during the training and probe tests were monitored by using
an automatic tracking system (DCR-SR42E, SONY). The data were recorded by an
experimenter who was blinded to the treatment the rats had previously received.
Production of Lentivirus encoding IGF-2 gene
The coding sequence of IGF-2 was amplified by RT-PCR. The primer sequences were:
forward, 5’-GAGGATCCCCGGGTACCGGTCGCCACCATGGGAATCCCAATGGGGAA-3;
reverse, 5΄- TCCTTGTAGTCCATACCCTTCCGATTGCTGGCCATCT -3΄. The
PCR fragments and the pGV 287 plasmid were digested with Age I and then ligated
with T4 DNA ligase to produce pGV287-IGF2. EGFP was fused to C-terminal of
IGF-2 to produce pGV287-IGF2-EGFP. The plasmid was used to transform
competent DH5α Escherichia coli bacterial strains for identification. Using 100 μl
Lipofectamine 2000, 293T cells were co-transfected with 20 μg of the pGC-FU
plasmid with a cDNA encoding IGF-2, 15 μg of the pHelper1.0 plasmid, and 10 μg of
the pHelper 2.0 plasmid to generate the recombinant Lentivirus LV-IGF2-EGFP.
After 48 h, supernatant was harvested from 293T cells, filtered at 0.45 μm, and
pelleted by ultracentrifugation at 4,000× g for 10–15 min at 4°C. After resuspension,
serially diluted lentivirus was used to transduce 293T cells; 4 days later, the labeled
293T cells were counted to calculate the viral titer.
Gogli staining
Golgi staining was performed as described previously (Li et al., 2008; Wallace et al.,
2006).In brief, after euthanasia by means of isoflurane overdose, brains of rat
offspring were removed and excised for Golgi impregnation. The staining procedure
was carried out using the FD Rapid GolgiStainTM kit (FD Neuro-Technologies Inc.).
Brains were placed in a Golgi–Cox solution and stored in the dark for 14 days,
following which they were incubated with 30% sucrose at 4o C for two days prior to
sectioning. Coronal sections were cut to a thickness of 100 µm on a cryostat (Shandon
Cryotome, Thermo Electron Corporation). The sections were serially collected,
dehydrated in absolute alcohol, cleaned in xylene, and cover-slipped with a resinous
medium
Supplemental Table 1
General parameters in the offspring of the control or morphine exposure groups
F/M: Female/Male; 3W: 3 weeks；8W: 8 weeks; Morality rate: number of offspring
remaining on postnatal day (PND)-60 divided by total number of offspring on PND-0.
Supplemental Figure 1
Supplemental figure 1. Effect of parental morphine exposure on learning and
memory in their offspring. A and B, Latency to find the platform in the male (A) and
female offspring (B) of the control or morphine-exposed groups. C, Time in target
quandrant. No significance was observed in the latency to find the platform in the
male and female offspring among the control and morphine exposure groups (F(3，
84)=1.021， p>0.05 in male offspring, F(3， 84)= 0.576, p>0.05 for female offspring) .
One-way ANOVA followed by Bonferroni post hoc test.
Supplemental figure 2
Supplemental figure 2 Effect of morphine exposure on the maternal behaviors in
postpartum female rats. Duration of crouching (A), duration of pups retrieved (B),
duration of pup licking and duration of nest building were examined in the postpartum
female rats with different groups. No significant difference was observed in duration
of crouching (F(3,15)=0.078, p>0.05); duration of pups retrieved (F(3,15)=0.177，
p>0.05); duration of pup licking (F(3，15)=0.508 ,p>0.05) and duration of nest
building (F（3,15）=0.038, p>0.05).One-way ANOVA followed by Bonferroni post
hoc test.
Supplemental Figure 3
Supplemental figure 3. Effect of adolescent enriched environment (EE) experience
on the dendritic morphology in dentate gyrus in the adult offspring. Offspring of the
morphine exposure or control groups received EE experience in adolescence and
measures of dendritic morphology in the adult. (A-C), Quantitative analysis of
dendritic length (A); number of branching points (B); and spine density as indicated
by number of spine per m (C). Note that after EE experience, no significant
difference was observed in dendritic length, branching number or spine density
between the offspring of the control and experiment groups with adolescent EE
experience.
References
Li CQ, Liu D, Huang L, Wang H, Zhang JY, Luo XG (2008) Cytosine arabinoside
treatment impairs the remote spatial memory function and induces dendritic retraction
in the anterior cingulate cortex of rats. Brain Res Bull 77:237-240.
Wallace M, Luine V, Arellanos A, Frankfurt M (2006). Ovariectomized rats show
decreased recognition memory and spine density in the hippocampus and prefrontal
cortex. Brain Res 1126: 176-182.
Zhao C, Li M (2012). Neuroanatomical substrates of the disruptive effect of
olanzapine on rat maternal behavior as revealed by c-Fos immunoreactivity.
Pharmacol Biochem Behav 103: 174-180.