Cloning the Saccharomyces RAD23 Gene in Tetrahymena
David Brannan
Lab Partner-Shannon Smith
10/10/08-BMS 110/999
Lab Report
Abstract:
This lab report contains the steps and results of a project that seeks to clone a gene of
Tetrahymena thermophila into a plasmid. If successful, the cloned gene of the
Tetrahymena plasmid could possibly be used for future research. For this experiment, we
are seeking to clone the corresponding gene of Saccharomyces RAD23 in Tetrahymena.
The protein Saccharomyces RAD23 is used for DNA repair through Nucleotide Excision
Repair (NER) which removes DNA lesions. However, Saccharomyces RAD23 is an
accessory protein that helps maintain peak function, but isn’t essential to NER simply
taking place. These functions of RAD23 suggest that the corresponding gene in
Tetrahymena may have similar abilities; and that successfully cloning this gene into a
plasmid may lead to results that could be applicable to genetic research. The processes that
are included in this lab report include Bioinformatics, isolating DNA, amplifying DNA,
testing it with electrophoresis, cloning DNA, inserting it into E. coli, creating a plasmid
map, and purifying the plasmid with restriction enzyme digest. The results from the
majority of the labs were fairly successful, though some failures were encountered.
Overall, the results of these experiments were satisfactory until the TOPO cloning reaction
failed to form colonies. Due to this, we used colonies for the final lab from another lab
group that successfully formed colonies with RAD23. When we carried out the plasmid
purification and restriction enzyme digest, the results failed to yield plasmids that could be
1
Abstract: (Continued)
used for future research. Therefore, in order to achieve a product, we would have to start
back at the TOPO cloning reaction and make another attempt to have it work. If that fails,
the most promising place to restart would probably be to once again isolate the gDNA of
Tetrahymena.
Introduction:
In this project, we are seeking to clone the corresponding gene of the protein
Saccharomyces RAD23 in Tetrahymeana to create a plasmid that could potentially be used
for research. Tetrahymena are free living ciliate protozoa that are common in fresh water,
used for research, and have a variety of complex and specialized cell structures. The
protein Saccharomyces RAD23 is involved in Nucleotide Excision Repair (NER);2,3 which
serves as a DNA repair mechanism for possible mutations. The RAD23 gene was originally
found in yeast, but has since been found to perform a variety of functions including binding
to DNA during replication, initiating the targeting of proteolytic substrates, and being
partially responsible for ultraviolet induced DNA repair. The importance of RAD23 can be
easily seen in DNA replication. When RAD23 doesn’t function correctly or is absent in
DNA replication, the phosphate base thymine binds with another thymine, as opposed to
adenine (the proper binding pair). In humans, this abnormality causes Xeroderma
pigmentosum, which makes human skin unable to repair itself, and therefore precludes an
individual from getting UV exposure8. This information displays the importance that
RAD23 plays in NER and though not completely essential to it, it fulfills a crucial role.
2
Introduction: (Continued)
Given the importance of the protein Saccharomyces RAD23 in NER, successfully cloning
the corresponding gene in Tetrahymena could be used to research certain genetic
abnormalities. In this case, cloning refers to isolating a defined DNA sequence and
obtaining multiple copies of it1. Cloning has essentially four processes: fragmentation,
ligation, transfection, and screening/selection. Fragmentation is where the DNA is
essentially separated into fragments and amplified, usually through Polymerase Chain
Reaction. Ligation is a procedure where the amplified fragment is incubated with the
enzyme DNA ligase under appropriate conditions. Transfection is the process where the
DNA is transfected into cells, which can be done chemically or through electroporation.
Finally, the transfected cells are cultured. Ultimately, the goal of this project is to clone a
gene of Tetrahymena into a plasmid that could be used by other researchers.
3
Materials and Methods
Bioinformatics
The amino acid sequence of Saccharomyces RAD23 was found through the database
www.ncbi.nlm.nih.gov, and the corresponding Tetrahymena homolog was found through
the webpage www.cilitate.org. The top three results can be found in the results section.
The IPI (Human) and SGD protein homologs for the TTHERM_# were also found and
recorded. The protein sequence of the Tetrahymena homolog was found with a ORF
Translation coding sequence and labeled Tt RAD23 amino acid using the webpage
www.ciliate.org. The Tetrahymena homolog with the highest e-value was used to find the
nucleotide sequence with the www.ciliate.org resource and labeled as Tt RAD23 CDS. The
genomic sequence of Tt RAD23 was found with the highest TTHERM_# at
www.ciliate.org. With the same resource, the Tt RAD23 sequence was found with NTS and
underlined EST’s. Finally, the amino acid sequence of Saccharomyces RAD23 was
compared with the sequence Tt Saccharomyces RAD23; a second comparison was made
between the amino acid sequence of Saccharomyces RAD23 and the results of the first
comparison using the website www.ncbi.nlm.nih.gov.
4
Tetrahymena Genomic DNA Isolation
First, 1.4mL of Tetrahymena culture was pipeted into a microcentrifuge tube. The tube was
then placed in the centrifuge for one minute at 10,000 revolutions per minute; afterwards
the supernatant was removed. The pellet that was formed from the centrifuge cycle was
then flicked to loosen residual supernatant, and 700µL of Urea Lysis Buffer was added to
the tube to protect the pellet from a possible change in pH. Next, 600µL of phenolchloroform was added to the tube; the tube was then mixed. The tube was placed into the
centrifuge for 5 minutes; the top layer was then transferred to a new tube. The process from
when the phenol chloroform was added to now was repeated. 150µL of 5M NaCl was
added to the removed lysate. To precipitate the DNA, 700µL of isopropyl alcohol was
added to the lysate; the tube was then inverted 10 times, stood for 10 minutes, and was
centrifuged for 10 minutes. After centrifuging the supernatant was removed and 500µL of
70% ethanol was added. The tube was then centrifuged for 3 minutes, supernatant was
removed, and the pellet was air dried. 50µL of Tris-EDTA was then added to the tube and
mixed; 1µL of RNase A was added and the tube was incubated at 37 °C for 10 minutes.
Finally, the tube was labeled accordingly.
5
Polymerase Chain Reaction
First, the primers that were designed for my reaction were distributed by the instructor and
were resuspended with the appropriate amounts of sterile ddH2O. The stock solution was
determined to have a final concentration of 200uM; it was later diluted in a different tube to
have 200µL of a 20uM, which will be called the working stock. The amount of sterile
ddH2O to add to each was then calculated to be: Gene TF=136.5µL, and Gene TR-163.0µL.
Figure 1.
The coding sequences below represent the coding sequence for the primers that were
ordered for both the RAD23-TF and RAD23-TR genes to isolate the genomic DNA of both
through PCR.
RAD23-TF (34-MER; TM=54°C)
5’-CAC CCT CGA GAA GAT CAA CAT TAA GAC TTT AAA G-3’
RAD23-TR (30-MER; TM=54°C)
5’-CCT AGG TCA TTA ATA CAT AAA ATC ATC GTC-3’
The water was added after briefly centrifuging the tube. The working stock solutions were
then created. The PCR reactions were now set up according to the calculations made in the
Pre Lab5. Four reactions were set up; that is two genomic DNA with primers for each
person. Our solutions were divided as follows: 1-DB gDNA, 2-DB gDNA, 3-SS gDNA,
and 4-SS gDNA. The two letters before each reaction represent the initials of me and my
lab partner. The master mix was then created, and as was the working stock; the
components can be found in Figure 2.
6
Polymerase Chain Reaction (Continued)
Figure 2.
The following table shows the amount of each ingredient that was used to make the mixes
for the four genomic primers as well as the master mix.
Final concentration
Stock concentration
Master Mix
1.0 µg (total) genomic DNA
0.43 µL
2.32_ (calculated)
0.2 μM sense primer
1.25 μL
20 μM x 3
3.75uL
0.2 μM antisense primer
1.25 μL
20 μM x 3
3.75uL
1 unit (U) Phusion polymerase
0.5 μL
2 U/μL x 3
1.5µL
1X HF or GC buffer (1.5mM MgCl2)
10_ μL
5X concentrated x 3
30 µL
0.2 mM dNTPs
Sterile distilled water
1_ μL
10 mM x 3
3 µL
35.57μL
x3
106.7 µL
_______________________________
FINAL VOLUME:
1.29 µL
_______________________________
50 μL
150 μL
The correct amount of master mix was then pipeted into each tube; to make a
total volume of 50µL in each tube. When this was complete roughly 48µL of master mix
remained. The four tubes of primer were then placed in a thermocycler at the closest
temperatures available to those calculated in Pre-Lab 5(can also be found in results). The
thermocycler will then take the primer tubes through an incubation process that will heat up
and cool the primers to amplify the DNA.
7
Agarose Gel Electrophoresis
Agarose gels in electrophoresis chambers were already in place for the beginning steps of
this experiment. First, the comb and side walls of the gel covering were removed and 1X
TAE was poured into the electrophoresis chamber until the top had only a thin layer over it.
Sample dye (1 µL dots) had been previously made by the laboratory instructor. The first
slot that the comb made in the gel was filled with 5µL of 1 kb ladder. Next, 10µL of each
primer was mixed with the dyes and placed in the gel slots. With the primers in place, 90
volts of electricity were then added to the electrophoresis chamber for 75 minutes. The
sample dyed primers that were placed into the gel slots eventually came close to the middle
of the gel. The gel apparatus was then visualized to determine the quality of the primer.
8
TOPO Cloning and E. coli Transformation
We began setting up the TOPO cloning reactions by adding the necessary components. The
following represents the quantities that were calculated to be necessary for the TOPO
cloning reaction. The amount of PCR to be used was determined by visually comparing the
ladder key of base pairs (bp) with the SS-4 gDNA image that was taken in lab 7(Result 4Figure 2). It was visually determined to be 250ng, which went through the following
calculation: (250) x (10) x (0.1)=250ng. The amount of PCR product was determined by
10µL 250ng=0.04µL/ng. It was determined that 10
250=0.04ng; therefore 0.04ul/ng x
10ng=0.4µL; 0.4µL of PCR product will be added to the solution. The other solutes that
were added to the TOPO mix are as follows: Salt Solution: 1µL and TOPO Vector: 1µL.
Since the final volume of the solution must be 6µL, the amount of sterile water to was
calculated as follows: 6µL-1µL -1µL -0.4µL =3.6µL of sterile water. After calculating and
combining the solutes, the solution was mixed by pipeting up and down. The tube was then
allowed to sit for 10 minutes at room temperature. Next, we thawed our 5mL tubes of E.
coli for 5 minutes, after doing so we added 2µL of the TOPO solution made previously to
the E. coli tube and gently mixed them with a pipet tip. The E. coli tube was then incubated
on ice for 10 minutes. After incubating, the E. coli tube was heat shocked for 30 seconds in
a 42 °C tub of water and was immediently transferred to ice. After transfering to ice,
250µL of SOC Medium was added at room temperature. The tube was then placed in a
horizontal shacking incubator for 50 minutes. Once the incubation was complete, roughly
20 sterile glass beads were added to two different plates. Now, 200µL and approximately
50µL of the TOPO mix were added to each plate. The plates were swirled with the beads to
ensure that the solution was adequately spread.
9
TOPO Cloning and E. coli Transformation (Continued)
The beads were then removed from the two plates and incubated overnight at 37 °C.
Constructing a Plasmid Map and Restriction Enzyme
Digestion Design
Plasma Maps are graphical representations of plasmids that show the major sites such as
genes, plasmid names, and restriction enzymes. The first step was to retrieve the RAD23
Tetrahymena Sequence and the plasmid sequence used to clone the PCR product from the
online Blackboard resource. After acquiring these sequences, a gene construction program
was opened to create the plasmid map. The program then opened a circular plasmid that
had the RAD23 Tetrahymena sequence inserted into it. We next found the region where the
gene will be inserted between the brown colored sequences where the sequence was blue
and read CACC. This sequence matched part of the primer sequence made for our primers.
The CACC was then highlighted and pasted into the gene sequence and the junction marker
was highlighted and deleted. We next changed the gene sequence to green; and highlighted
the intron sequences and copied them. The RAD23 sequence was then pasted in the gene
construction program; all the introns were highlighted and changed to the color black. We
then went back to the plasmid and highlighted the green and black regions. The gene
10
Constructing a Plasmid Map and Restriction Enzyme
Digestion Design
(Continued)
construction kit was used to change the green and black regions to the ‘widest line’ setting
on the plasmid map. The plasmid map was then saved as pENTR, TtRAD23. The
previously saved plasmid map was used to mark the restriction enzyme sites found in the
handout from Lab 7(see lab notebook for handout). A toolbar was opened and the program
was set to ‘Commercial’ and each constriction enzyme was added. The program then
displayed all the sites found in the plasmid that correspond to a certain palindromic
sequence. The plasmid map was then evaluated and it was determined that the NHE1
restriction enzyme was the best for determining that the RAD23 gene was in the plasma.
The NHE1 sequence was then highlighted and copied. The document type was then
changed to Gel; the gel bands from the digest were pasted in. The size of the DNA was
then changed by setting the threshold to 500 base pairs. The gel picture was saved as
pENTR, TtRAD23, NHE1 digest. The gel was changed to a table and saved as pENTR,
TtRAD23, NHE1 Table. All of the documents were then saved for future use and reference.
11
Plasmid Purification and Restriction Enzyme Digest
The first step in this lab was to grow the bacteria that would be used later in the lab. We
began by taking 6ml of LB with 50µg/ml Kanamyacin in three different glass test tubes(six
total, three per person). A LB/KAN plate was labeled pENTR, TtRAD23, DBSS; a grid
was drawn on the plate that contained six numbered squares. We then used sterile six inch
wooden sticks to take colonies from the colonies transformation plate and mark them on the
grided plate. It must be noted for this experiment that we used colonies from lab students
that were also assigned the RAD23 gene. The remaining material on each wooden stick was
mixed with the liquid in the LB/KAN test tube. The test tubes were then placed in the
shacking incubator at 37 C overnight. Next, a total of eighteen 1.5ml tubes were labeled as
1A, 2A, 3A, 2A, 2B, 2C, etc. Culture was then pipeted into each tube with roughly 1ml left
in the test tube. The tubes were centrifuged at maximum speed for three minutes. The
supernatant was removed from each tube. We then added 250uL of buffer P1 to each A
tube of the six sets. The pellet was then resuspended by pipeting up and down; after
pipeting, the contents of each A tube were transferred to the B tube and resuspended.
Finally, the contents of the B tube was transferred to the C tube and resuspended. We
added 250µL of Buffer P2 to the C tube and inverted it to create a through mix. The
solution then turned blue, but after gaining a through mix we turned the tube right side up
and added 350uL of Buffer N3 to ensure the plasmid DNA wasn’t damaged. The tubes
were then inverted until the solution turned clear and was homogeneous; and the tubes were
centrifuged at maximum speed for 10 minutes. Pipets were then set to 900µL and used
remove the supernatant (roughly 850µL) from the tubes and pipeted into QIA prep spin
12
Plasmid Purification and Restriction Enzyme Digest
(Continued)
columns. The QIA prep spin columns were then centrifuged for 1 minute and the flow
through top of the spin column was removed and discarded. We next centrifuged the tubes
for 1 additional minute to remove any residual buffer. The column was placed in a new
1.5ml tube with 50µL of Elution buffer. The tube stood for 2 minutes, and was centrifuged
for 1 minute; the column was then discarded. The tubes were placed on ice with the labels
1Rad23DB and 2Rad23SS. We now confirm the plasmid by inserting the plasmid PCR
with restriction enzyme digest. The restriction enzyme was determined to be NHE1 from
the previous lab and the restriction buffer to be used is NHE1 Buffer 2. It was also
determined with the handout that the reaction will require a BSA. We then created a
cocktail that included the following: 14µL of Buffer2, 1.4µL of BSA, 3.5µL of NHE1
Buffer 2, and 107.1µL of sterile water. We then pipeted 18ul of the cocktail in six tubes
and labeled the tubes with DBSS, NHE1, and the plasmid number (1-6). We next added
2µL from the plasmid tube to the corresponding cocktail tube; which was incubated at 37
°C overnight. Finally, we determined the quality of the primers through Agarose Gel
Electrophoresis (steps can be referenced in the Agarose Gel Electrophoresis Part of
Methods) to determine if the samples will have the necessary qualities to be used in the
future.
13
Result 1-Bioinformatics
CACCGTCGAGAAGATCAACATTAAGACTTTAAAGGGCACTGATTTTTTTGATGTTAACCTT
GAAGAAACTGCTACAGTAAATTTATTAAAATGTTTTGTTTTAGGAGAGCTCGAATTCTTGT
TGACATTTTAAGAATTAGCTAGATAAATACTTGTTTTCAACATATTTTATAATCTTGTTAG
GTTGCTGAATTGAAGGAGAAGATTGCTACTGAAAAGTAAAAGGAAAAAGATACTATTAAGT
TAGTTCATAAAGGTAAATAATTGACCGAAGACTCTAAGACTCTTGGCGAACTTGGTATTAA
AGATAATGATTTTGTTATTCTCATGTTCTTTTAAAAGGTAATATTATCTTAGTTTTAAGAT
TTCTTCAAAATGCGGCTATCTATTTATTTCTCTTTCTATGTGTGCTTTCTTTTAATCATGA
TTAAATTAGAAAAATTCTTCAAAAAATGAAGTAAAATCAATATTTTCTTTGTCGAATTGTA
CACAATTTAATGTGACATGACACTGAAATCATCTTAGTGACTGTTAAGCATTTTAATAGAT
GAATAATAGATAAAGTAGCATAGAAAGCAGAGAAAATTTTATGGCTAGCATTTAATGAAAG
AAAGAAAGAAAGAATGAAATTGCAATTATAATTTAAAAAATAATAAACTAAATATAACATT
ATTATAGAAAGCAGAAAAAGAAGATGCTCCATAATAAGCTTAATCTGATACCACTTCTACT
ACCTCCGCTGCCTCAACAACTGCTACTAACCCCACTACTGTTCCTAAGCCTGCTGTTTCCT
AACCCGCTACAACATAATAAACAGGAAGTTAAGGAACAGGTAGTGATCTCCTTTAAGGTCC
TGAATTGGAAGCCAAAATTAAAGAAATTGAATCAATGGGTTTTGAAAGACCTAAGGTTCTT
TAAGCTTTGAAGGCCGCTTATTACAATCCTGAAAGAGCAGTTGATTATTTACTCAGTGGTA
ATATTCCTAAAGAACCTAGTTAATAATAGAGTCCTTTACAAGGCTTACAAGGTCCTGGTGT
TGAATAATTAGCTTAATTAGCTTAAAATCCTCAATTCCAACACATTGCTTAAGCTATTCGT
TAAAACCCTGCTCTTCTCCAACCTGTCATGTAATAATTAGCTTAAACTAACCCTGATGTTG
CCAGACTTTTACAATAAAACCCTCAAGCTTTCTTGCAACTCCTCCTTGCTGCCTCTGAAAA
CGAAGGTGGATAAAGTAATAATTTTAAATTGTTAATTTTTCATGGACTTTAAATGCTAAAA
TAATTGACAAAAGAAAGTCTTTTACTTTTCCATTAAAGACAAAAAGAATATAAATTCTTGT
ATCTGTCTTTCTTTCTTTCTATCTATTTATCTTTCTATTGATTGATTTAAATAATCTGATC
TGATTAAAGAAAATAGAAAAGAGCAGAATTGATTAGTTAGCATATCTTCTTCGTTTTTCTA
TTTATTTTTTAATAAAAATTAATCTTTAAAATTAATTAGCCTTACCTCCAAATGCCATCCA
AGTCACTCCTGAAGAAAAAGCTGATATTGATGACATTATTTCTATGGGTTTTGATAAAAAT
GACGCCTTAGAAGCATATATTACCTGCGACAAGAACAAAGAATTAGCAATTAACTATCTTT
TCGAAGCAAGGGAAAGCGGTACTCTTCTTTGTAAGAAATATTAACTTTTTTTTTTTTAATT
CAAGAAAGCAAGCAAGTTTAAAAAAGCAATTGTGTATATAAATAAATCATTAAATTAAAAT
AAGAAATAGTTGAAAAAAAAGATATTCATTCATCCATTCACATAGTAAATATTCTAAATAA
ATTTTTATTTAATTAAATAGCTGAACACATCCAAAAGGAAGAATTAGAAGCTGCATAATAA
TAATCATAAAACTAAAATTAATAACAATAAGGTAATAACCCAAATCAATAATAATAATAAG
GTGGATAAGGTGAAGGTGGTGATAATGATGATGAAGATGACGATGATTTTATGTATTAATG
ACCTAGG
Figure 1:
The above coding represents the genomic sequence of DNA for the gene Tt RAD23; the
above figure represents Tt RAD23 Genomic= 2020 Base Pairs (bp) or cDNA= 1195 bp.
The black part of the sequence represents the introns that are removed from the genomic
sequence of RAD23. The red shows the sequence that is present in mature RNA, and the
highlighted yellow portions represent the sequence of primers that are used to amplify the
TtRAD23 gene in the PCR process.
14
Result 1-Bioinformatics
Result 1.1-Bioinformatics Written Results
The top three results for TTHERM_# were the following: TTHERM_00013290/2.2e-17,
TTHERM_00085190/0.033, and TTHERM_00346560/0.043. The TTHERM_# used to
find the genomic sequence of DNA was TTHERM_0034560. It must also be noted that the
black introns in Figure 1. are regions of DNA that are not transported to proteins7.
Result 2-Quantifying the Genomic DNA of Tetrahymena
Result 2.1
After acquiring the genetic coding sequence for TtRAD23, we began to isolate the genomic
DNA of the Tetrahymena. The following shows the results from when two sets of DNA
were isolated for genomic DNA. The two dilutions of DNA were placed in a
spectrophotometer and tested at both A260 and A280 wavelengths of light. The results for
each solution are shown in the information below:
Result 2.1
1:100 dilution
1:200 dilution
A260
A280
0.006
0.008
A260
A280
0.089
0.047
Result 2.3
A discrepancy resulted in the numbers that we received during lab and those the lab
instructor received for the 1:100 dilution. For the purpose of calculating DNA purity, I
choose to use the instructor’s numbers, which I believe are the correct ones.
Result 2.3
1:100 dilution
A260
A280
0.464
0.220
15
Result 2-Quantifying Genomic DNA of Tetrahymena
Result 2.4
The DNA stock concentration was determined with the numbers that the lab instructor
determined.
Formula for stock concentration- (50) x A260 x Dilution Factor
1000mL
The dilution factor for this process is 100; because we have determined to use the 1:100
dilution, since it has a higher quality.
Final Results- (50) x (0.464) x (100)
1000mL
Final Stock Concentration=2.32 µL/mL
Result 2.5
The DNA purity was determined with the following equation; and for this purpose any ratio
above 1.7 would be considered good:
A260
A280=2.1
Result-3-Polymerase Chain Reaction
Result 3.1
The information below shows the calculated temperatures for the four primers. In this
experiment four primers were created, two by each lab partner. These temperatures were
calculated as follows: 1) Added 58.6 °C to 53.9 °C and the average is temperature 1, 2) The
predetermined temperature for gene, 3) Predetermined Temperature for our gene, 4)
Predetermined Temperature for our gene.
Rxn #
1)
genomic template; primer annealing temperature #1
__56.25°C _
2)
genomic template; primer annealing temperature #2
__58.6°C __
3)
genomic template; primer annealing temperature #3
__53.9 °C (same as rxn 1)
4)
genomic template; primer annealing temperature #4
__50.0°C (same as rxn 2)
16
Result 3-Polymerase Chain Reaction
Result 3.2-Polymrase Chain Reaction Written Results
The quantities that were added to the four tubes are represented in the Final Concentration
column; and the quantities of the master mix are represented in the column titled Master
Mix (Table with information can be found in Polymerase Chain Reaction Figure 2). At the
end of this exercise roughly 48µL of the master mix remained from creating the four 50µL
genomic DNA primers. The effectiveness of the PCR product will not be fully known until
the DNA is examined for use in cloning.
17
Result 4-Agarose Gel Electrophoresis
Figure 2
3,000 bp
2,000 bp
1,000 bp
(5) (4) (3) (2)
(1)
(1)- 1uL of kb ladder
(2)- DB-1 genomic primer that was incubated in the thermocycler at the closest
temperature to 56.26 °C (essentially no result)
(3)- DB-2 genomic primer which was incubated in the thermocycler at the closest
temperature to 58.6 °C (essentially no results)
(4)-SS-1 genomic primer, which had fairly good results, though some primer dimmers
are present. The fourth primer was incubated at the closest temperature to 53.9 °C.
(5)- SS-2 genomic primer, which will be the selected primer to insert in a cell for
cloning purposes. This primer was incubated at the closest temperature to 50.0 °C.
18
Result 5-TOPO Cloning and E. coli Transformation
Written Results-TOPO Cloning and E. coli Transformation
The end results of this lab proved to be unsuccessful since colonies failed to form during
the incubation period after the lab methods were completed. The unsatisfactory results of
this lab could have been due to a variety of variables and mistakes.
19
Result 6-Constrcuting a Plasmid Map and Restriction Enzyme
Design
Figure 3.
Result 3. Plasmid Restriction Enzyme Digest
The above plasmid map shows the results of our plasmid. It includes present genes,
restriction enzymes, and cloning sites. The arrows show the restriction enzyme for our
plamsid.
20
Result 6-Constructing a Plasmid Map and Restriction Enzyme
Design
Figure 4.
Result 4.
The above figures show the Digest Table and the Bands Present in our Plasmid.
21
Result 6-Constructing a Plasmid Map and Restriction Enzyme
Design
Result 6- Constructing a Plasmid Map and Restriction Enzyme
Design Written Results
The plasmid map above was created using a Gene Construction Kit. The most prevalent
restriction enzyme present was determined to be NHE1. The plasmid map also confirmed
that Saccharomyces RAD23 was in the plasmid.
22
Result 7-Plasmid Purification and Restriction Enzyme Digest
Figure 5.
(1) (2) (3) (4) (5) (6) (7)
Figure 5.
The following displays the correlation between the numbers listed above and what they are
depicting in the image: (1)=1 kb Ladder, (2)=DB1Plasmid, (3)=DB2Plasmid,
(4)=DB3Plasmid, (5)=SS4Plasmid, (6)=SS5Plasmid, (7)=SS6Plasmid
23
Conclusion:
The results of this experiment were marked by both success and failure. Although the
majority of the steps in this lab project went fairly well, a few mistakes were made. The
first success came in the Bioinformatics lab when a Tetrahymena homolog was located for
Saccharomyces RAD23. In the next lab, when the Tetrahymena gDNA was isolated, I
believe that an error in pipeting occurred when the 1:100 dilution of DNA was placed in the
spectrophotometer. When the 1:100 dilution was measured at 260nm and 280nm two
different times; there were different results. In the process of Agarose Gel Electrophoresis I
also believe that an error occurred when two of the PCR Products were pipeted into gel
slots. I think I failed to properly insert the samples into the slots, which caused them to not
show up correctly in the Gel Electrophoresis image. However, the other two gel slots came
out with fair quality and suggested that the upcoming step would be a success. The TOPO
Cloning and E. coli Transformation, however, failed to yield colonies. This could be due to
a number of variances including unsterile plates, an error in calculation, contamination of
the TOPO mix, or a faulty E. coli sample. Whatever the cause, in order to make
transfection occur, the TOPO Cloning and E. coli Transformation lab should be repeated to
determine if colonies form, or if the polymerase was faulty and the process should start
back at gDNA isolation. Although the TOPO reaction failed to make colonies, I and my lab
partner were able to complete the project with colonies from other lab students with the
RAD23 gene. The Plasmid Purification and Restriction Enzyme Digest lab was one of the
more difficult labs to carry out since it required a number of steps and more than one lab
period. The end results of this lab ended up being a failure since the plasmid that was
tested with Agarose Gel Electrophoresis ended up being of unusable quality. The failure of
24
Conclusion: (Continued)
this lab could have been due to a contamination of any number of steps, since the lab
contained so many. I think that a problem could have occurred in creating the cocktail,
keeping the tubes sterile, pipeting without causing contamination, or just simply that the
project failed to work (Murphy’s Law). In short, this project was definitely an educational
one since many laboratory instruments were used for the first time. A vague sense of
familiarity with online resources, pipets, following laboratory instructions, and other skills
were gained from this project. In the future, this experiment could be carried out with more
quality since an increased adroitness has been achieved with collecting information, using
laboratory equipment (pipet), and following predetermined directions with minimal
difficulty. In addition, future improvements in carrying out this experiment would be most
effective in areas of procedure and records. Labeling tubes more effectively, minimizing
the reuse of pipet tips, and keeping a more accurate record of steps would make carrying
out this experiment subject to fewer errors. From this experiment, I received an
understanding of the scientific processes needed to acquire data, and an introduction to
using laboratory equipment.
25
Reference:
1- ^ McFarland, Douglas (2000). "Preparation of pure cell cultures by cloning". Methods in
Cell Science 22 (1): 63–66. doi:10.1023/A:1009838416621. PMID 10650336
2345-
Alfred M. Elliott (1973). Biology of Tetrahymena ISBN 0-87933-013-9
www.osti.gov/energycitations
DNA repair and Mutagenesis (2nd edition), Errol C.Friedberg et.al
Lipps G (editor). (2008). Plasmids: Current Research and Future Trends. Caister
Academic Press. ISBN 978-1-904455-35-6
6- Pre Lab Exercise 5(Calculations)-BMS 110/Section 999 Fall 2008
7- P Mark Lefers. intron (intervening sequence)". Department of Biochemistry, Molecular
Biology, and Cell
Biology, Weinberg College of Arts & Sciences, Northwestern
University. Retrieved on 2008-06-17
8- M.A. Liebert (1998) Human Gene Therapy. ISSN, 1043-0342
26