Biology 2
2005
Name:________________
/30points
How do you go from gene to protein??
Each chromosome is made of many genes. Each gene is made up of a specific DNA sequence
which codes for a specific amino acid sequence, otherwise called a protein. These proteins result in
the presence or absence of particular traits, or phenotypes. The process of going from gene, or DNA,
to protein involves a series of steps including transcription of DNA to mRNA and translation of mRNA
to amino acids (protein).
1. Let’s use the gene that codes for the enzyme amylase in your saliva. Here is the gene’s DNA
sequence: TACATACGGTTACGATTACGAACT
a. TRANSCRIPTION
Please create the mRNA transcript using the DNA template (above). Keep the following
points in mind:




The DNA and mRNA bases are complementary
C (cytosine) is complementary to G (guanine)
A (adenine) is complementary to T(thymine)
RNA doesn’t contain T, T is replaced with U (uracil)
DNA sequence: TACATACGGTTACGATTACGAACT
What is the mRNA sequence?______________________________ (2 points)
*should only have A, U, C, and G in your mRNA*
b. TRANSLATION
Now that you have your mRNA transcript, read the codons (sets of 3 bases), and translate
it using the genetic code into the correct amino acid sequence.
What is the amino acid sequence? __________________________________(2 points)
*Remember to read the mRNA sequence in sets of three*
Now rewrite your protein without the “stop” codon.
___________________________________________ (1 point)
*This is the primary structure of the amylase enzyme.
******SEE BACK SIDE*******
2. Use the same process outlined above to determine the protein for acute hearing.
DNA sequence: TACGGACTATGGCCATGACCGACT
a. What is the mRNA transcript? _____________________________________ (2 points)
b. What is the amino acid code?_____________________________________ (2 points)
c. What is the final primary structure of the protein?________________________ (1 point)
3. The protein for hair color is coded for by the DNA sequence:
TACGGCTAGCCGTAGCCTGACCAATATCAAACT. What is the final primary structure of the
protein? Please show all of your work (mRNA transcript and amino acid sequence) to receive
all of the credit. (10 points)
4. The protein for freckles is coded for by the DNA sequence:
AACTACGGCTTAAGTCGTACTTAGACTCTT. What is the final primary structure of the
protein? Please show all of your work (mRNA transcript and amino acid sequence) to receive
all of the credit. (10 points)