Supporting Online Material
Supporting Methods
Mice
C57BL/J6 OlaHsd mice were purchased from Harlan Winkelmann. Mitochondrial antiviral
signaling protein-deficient (MAVS-/-, B6/olahsd Cardiftm1)(1) and interferon-alpha receptor
deficient mice (IFNAR-/-, B6/olahsd.129V2/Pas Ifnar1tm1Agt)(2) were kindly provided by
U.Kalinke (Twincore, Hannover, Germany). Both MAVS-/- and IFNAR-/- mice were
backcrossed onto the C57BL/J6 OlaHsd background at least 20 times. Interferon regulator
factor 3 – deficient mice (IRF3-/-, C57BL/6J Irf-3tm1Ttg) (3) were kindly provided by A.
Kröger (HZI, Braunschweig, Germany), and have been backcrossed at least 6 times onto
the C57BL/J6 background. Mouse experiments were carried out using animals between 612 weeks of age. Mice were housed under specific pathogen-free conditions at the
Twincore animal facility, and all experiments were conducted according to institutional
guidelines for animal care and use and in compliance with regulations of German animal
welfare law.
Plasmid construction for in vivo immortalization
The hyperactive transposase pPGK-SB13 construct (4, 5) was used for Sleeping Beautymediated integration (kindly provided by David A. Largaespada, Univ. of Minnesota). The
pT3/EF1α transposon plasmid was used for all subsequent cloning procedures as
backbone (Xin Chen, UCSF, Addgene plasmid 31789). pT/KRas-G12V was constructed
by inserting KRas-G12V into the pT3/EF1α plasmid. The KRas-G12V encoding fragment
was generated by PCR using the plasmid pORF9-mKRas2 (InvivoGen) as template, using
the primers G12V-fw: ATGACTGAGTATAAACTTGTGGTGGT TGGAGCTGTTG and
G12V-rev: GTATTCACATAACTGTACACCTTG. For generation of pT3/EF1α-myrAkt1, the
fragment coding for the constitutively active murine Akt1 (myrAkt1) was isolated from the
plasmid RCAS-myrAkt (Sandra Orsulic, MSKCC, Addgene plasmid 11547) and cloned
into pT3/EF1α. For targeted knockdown of p53, we constructed the plasmid pT3/EF1αshRp53, which expresses a shRNA against p53 (shRp53). To this end, the shRp53
fragment was excised from the LMP-construct (Open Biosystems, Huntsville, Al) and
inserted into the pT3/EF1α transposon plasmid.
Plasmids
The plasmids pFK-Jc1, pFK-Luc-Jc1, pFK-Luc-SGR, pFK-Luc-SGRΔGDD, and pFK-LucJc1mCD81 have been described earlier (6-9).The plasmid pTRIP-pre-miR-122-puro was a
kind gift from Matt Evans (10). The lentiviral plasmids pWPI-hApoE-BLR and pWPImApoE-BLR encode the human ApoE3 or mouse ApoE variants. Lentiviral plasmids
pWPI-humanCD81-BLR, pWPI-mouseCD81-BLR, pWPI-humanOCLN-Gun, pWPImouseOCLN-Gun, pWPI-humanSR-BI-Gun, pWPI-mouseSR-BI-Gun, pWPIhumanCLDN1-BLR and pWPI-mouseCLDN1-BLR encode the human or mouse orthologs
of the four HCV entry receptors in the context of the self-inactivating lentiviral vector pWPI
as published previously (9). Lentiviral plasmids pSFFV_hu.pre.miR-122 and
pSFFV_mmu.pre.miR-122a encode human respectively mouse genomic miR-122
sequence (detailed cloning strategies available upon request).
Cell culture and generation of stable cell lines
Huh-7.5 cells as well as all subcloned in vivo immortalized mouse liver-derived cell lines
were cultured in Dulbecco's modified Eagle medium (DMEM; Invitrogen, Karlsruhe,
Germany) supplemented with 2 mM L-glutamine, non-essential amino acids, 100 U/mL
penicillin , 100 µg/mL streptomycin, and 10% fetal calf serum (FCS) (DMEM complete) at
37°C and 5% CO2. Stable cell lines expressing miR-122 were created by lentiviral gene
transfer as described earlier (7). Lentiviral particles were produced from 293T cells using
the three plasmids pCMVΔR.74 (11), pcz VSV-G (12) and pTRIP-pre-miR-122-puro
encoding the miR-122 genomic locus and a puromycin resistance (10), in a ratio of 3:1:3.
MLT-MAVS-/- miR-122 cells were likewise additionally transduced with lentiviral constructs
coding for either human or mouse ApoE and HCV entry factors using pWPI-derivatives
coding for the respective gene of interest (and blasticidin S deaminase (BLR) of
Aspergillus terreus or a GFP-ubiquitin-neomycin fusion protein (GUN) conferring
resistance against blasticidin or G418 respectively). After each round of transduction
selection was carried out for several passages in the presence of 2,2 ug/mL puromycin, or
together with 5 ug/mL blasticidin and 0,75 mg/mL G418 before successive transduction
rounds. Due to the absence of a further antibiotic resistance marker, m/hCD81-transduced
cells were subjected to cell sorting. To this end, 1x107 cells were stained with antibodies
specific for either hCD81 (5A6, 1:200, Santa Cruz, Santa Cruz, CA) or mCD81 (EAT2-PE,
1:40, Santa Cruz, Santa Cruz, CA) and sorted on a FACS MoFlo using a 100 μM nozzle.
Cells were sorted to 95-99 % purity and captured in DMEM complete with 50% FCS.
Histological and immunohistochemical analyses
For histological classification of the obtained tumor cell line MLT-MAVS-/-, 1 x 107 cells
were implanted subcutaneously on C57BL/6 mice. After tumor formation, mice were
sacrificed, tumor specimen were fixed in 4% buffered formalin and embedded in paraffin.
For histopathological analysis, samples were sectioned (2 µm) and stained with
hematoxylin and eosin (H&E) according to standard protocols. For immunohistochemical
characterization the following antibodies were used. The mouse anti-human CK19
antibody (eBioscience, clone BA17), the mouse anti-CK18 (Abcam, clone C-04), and the
polyclonal chicken anti-CK8 (Abcam, ab14053) were applied as primary antibodies.
AlexaFluor555-coupled secondary antibodies were purchased from Invitrogen.
miR-122 quantification
For quantification of endogenous and ectopically expressed mature miR-122,total RNA
was extracted from cell lines using the Nucleospin RNA II kit (Machery Nagel, Düren,
Germany). Liver biopsy specimens from patients with CHC were obtained during routine
diagnostic workup at the University Hospital Basel if more than sufficient material was
obtained for histopathologic examination, and the patient gave his or her written informed
consent in accordance with the Ethics Committee of Basel. Human biopsy RNA (n=15) as
well as healthy mouse liver (n=6) RNA was extracted with TRIzol reagent (Invitrogen)
according to the manufacturer’s instruction. Total RNA was reverse-transcribed with the
TaqMan microRNA reverse transcription kit (Applied Biosystems) providing hsa-miR-122
and small nuclear RNA U6 (U6 snRNA) specific RT primers. Detection of miR-122 was
performed with the TaqMan Micro RNA assay kit (Applied Biosystems) according to the
manufacturer's instructions.
RNA interference
MLT-MAVS-/-miR-122 or Huh-7.5 cells were transfected with siRNA specific for mouse
phosphatidylinositol 4-kinase III-alpha polypeptide (mPI4Kα) (5’AGUGAGAGGGCCAGUGAAA-3’) purchased from Dharmacon. Briefly, 48 hpost
transfection of HCV subgenomic luciferase reporter replicon RNA (Luc-SGR), cells were
detached and reverse-transfected with siRNA against mPI4Kα or an irrelevant siRNA at a
concentration of 50 nM using Lipofectamine RNAiMax (Invitrogen) following the
manufacturer’s protocol. Knockdown efficiency was determined 48 h post transfection by
quantitative RT-PCR and HCV RNA-replication was determined by luciferase assay and
normalized to irrelevant siRNA.
Quantitative RT-PCR
To quantify mRNA levels of mPI4Kα, total RNA was extracted using the Nucleospin RNA
II kit (Machery Nagel, Düren Germany) following the manufacturer’s protocol.
Subsequently, 2 µl were reverse transcribed into cDNA using PrimeScript First Strand
cDNA Synthesis Kit (Takara) and PCR was carried out using 400nm of primers
ASPmPI4Kα 5’-GAAATGTAGAGCCGGTTGGAGAG-3’ and SPmPI4Kα 5’GCCATTGACAACATCTGCAGGTG-3’ or Gapdh f 5’-CCTGCACCACCAACTGCTTA-3’
and Gapdh r 5’-TCATGAGCCCCTTCCACAATG-3’ together with SYBR Premix Ex Taq
(Takara), and were quantified by LightCycler480 (Roche) according to the manufacturer’s
protocol. All results were normalized to Gapdh mRNA levels that were quantified in
parallel.
Production of infectious HCVcc particles and infection assay
To determine if mouse liver-derived cells can be infected with firefly luciferase HCV
reporter virus Luc-Jc1 or Luc-Jc1mCD81 (9) infectious particles were harvested 48 and 72
h post transfection of Huh-7.5 cells as described above. Virus-associated infectivity was
analyzed by luciferase assay and titrated by limiting dilution assay (TCID50) as described
(13). For infection, 1,2 x 105 mouse cells were seeded in collagen-coated 6-well plates 24
h prior to infection. Cells were inoculated with concentrated, TCID50 normalized, Luc-Jc1
or Luc-Jc1mCD81 virus (MOI=0,4) for 6-8 h, followed by two washes with PBS to remove
residual virus and subsequent culture for 48 h with DMEM cplt or DMEM containing 2 uM
boceprevir. To analyze particle release, supernatants were harvested and used to
inoculate Huh-7.5 target cells and infectivity was measured by luciferase assay after 72 h.
HCV pseudoparticle (HCVpp) and HCV trans-complemented particles (HCVTCP)
infection
Lentiviral, HIV-based pseudotypes were essentially created as described (9). Briefly, 293T
cells were transfected with envelope glycoprotein expression constructs pcz-VSV-G (12),
pcDNA3ΔcE1E2 of H77 (GT1a), J6 (GT2a) or an empty vector control, lentiviral gag-pol
expression construct pCMVΔR.74 (11) and firefly transducing vector pWPI_Fluc_BLR
using PEI (Carl Roth, Karlsruhe, Germany).
HCVTCP were created by transfecting a subgenomic HCV replicon (Luc-SGR) into HCV
packaging cells stably expressing core, E1, E2, p7 and NS2, resulting in the production of
infectious virions carrying the replicon, as previously described (7). Supernatants were
collected at 48 h, and 72 h, concentrated and used for infection as described above.
Western Blotting
Western blot analysis was performed to detect expression of endogenous or stably
transduced human or mouse ApoE as well as HCV entry factors CLDN1 and OCLN after
lentiviral gene transfer. Cells were washed with PBS and lysed in RIPA buffer (0.3 M
NaCl, 20 mM TrisHCl (pH 8), 1% sodium deoxycholate, 0.1% SDS and 1% Triton X-100)
for 30 minutes on ice. Total protein content was determined by Bradford assay. Equal
protein amounts for each sample were mixed with 2× denaturing protein sample buffer
(200 mM Tris-HCl [pH 8.8], 5 mM EDTA, 0.1% bromophenol blue, 10% sucrose, 3.3%
sodium dodecyl sulfate [SDS], 2% 2-mercaptoethanol [2-ME]), heated for 5 minutes at
98°C, loaded onto a 11% SDS-gel and resolved by electrophoresis. Subsequently,
proteins were transferred to a polyvinylidene difluoride membrane which was then blocked
with 5% milk in PBS containing 0.5% Tween (PBS-T) for 1 h at RT. The membrane was
then incubated with α-CLDN1 (1:500), α-OCLN (1:200) (both Invitrogen) or α-hApoE
(1:1000; Calbiochem) or α-mApoE (1:400; Abcam) were detected with specific monoclonal
respectively polyclonal antibodies and secondary anti-mouse respectively anti-goat or
anti-rabbit antibodies coupled to horseradish peroxidase (Sigma-Aldrich, Steinheim,
Germany). Bound antibodies were detected with the ECL Plus detection system (GE
Healthcare, Freiburg, Germany).
FACS analysis
To analyze receptor expression, cells were harvested three days after plating using 2 mM
EDTA and 5 x 105 cells were stained with antibodies specific for either hCD81 (5A6,
1:200) or mCD81 (EAT2-PE, 1:40, both Santa Cruz, Santa Cruz, CA) or with a polyclonal
rabbit serum directed against SCARB1 (1:50, Novus Biologicals, Littleton, CO) in PBS
containing 2% FCS for 30 minutes on ice and washed with PBS. Non-coupled primary
antibodies were detected with secondary antibodies coupled to allophycocyanin (1:200,
eBioscience, San Diego, CA) or a-rabbit-Alexa Fluor-647 (Invitrogen) for 30 minutes on
ice. Following a PBS wash, receptor expression was detected with a FACS Calibur or
LSRII (Becton Dickinson, Heidelberg, Germany) and the results were analyzed using the
Flow Jo Software.
Immunofluorescence
Transfection efficiencies as well as influence of CyclosporinA on HCV replication were
visualized by indirect immunofluorescence as described previously (6). HCV-infected cells
were detected using the mouse monoclonal NS5A-9E10 antibody (kindly provided by
Charles M. Rice, Center for the Study of Hepatitis C, The Rockefeller University, New
York, NY) at a dilution of 1:2,000. Bound primary antibodies were detected using goat
anti-mouse IgG-specific secondary antibodies conjugated to Alexa Fluor 488 or Alexa
Fluor 546 (Sigma, Steinheim, Germany) at a dilution of 1:1,000. Nuclear DNA was stained
using DAPI at a dilution of 1:3,000.
Liver biopsies and informed consent.
Liver biopsies from patients with CHC (n = 15) were obtained in the context of routine
diagnostic workup. All patients gave written informed consent in accordance with local
ethical committees. RNA was extracted with TRIzol reagent (Invitrogen) according to the
manufacturer’s instructions.
Statistical analysis.
For statistical analysis, graphs were plotted to show the mean + SD. Statistical analyses
were performed using 2-Sample t-tests. P values < 0.1 were considered marginal
significant (*), p values < 0.05 were considered statistically significant (**) whereas p
values < 0.01 were considered highly significant (***).
Supporting Figures
Figure S1. MLT-MAVS-/- cells display characteristics of hepatocellular carcinoma (HCC) in
vivo. C57BL/6 mice were subcutaneously implanted with 1x107 MLT-MAVS-/- cells and
tumor sections were stained with (A) H&E for histopathological analysis or (B) with CK8,
CK18, and CK19 specific antibodies for immunohistochemical characterization. As a
control for the CK19 stain, a positive murine CCC sample with distinct structure was
stained simultaneously for the purpose of comparison.
Figure S2. HCV Replication in MLT-MAVS-/-miR-122 derivatives is inhibited by mouse
IFNα-1 and 2’CMA. Cell lines expressing ApoE and HCV entry receptors were transfected
with Luc-Jc1 RNA followed by treatment with either 500 U/mL mIFNα-1 or 5 ug/mL 2’CMA
4 h post transfection. Luciferase activity was determined 48 h post transfection and
depicted results are the means and standard deviations of at least two independent
experiments.
Figure S3. Receptor expression of MLT-MAVS-/- cells and derivatives expressing human
or mouse ApoE and HCV entry factors. Flow cytometry was used to determine the
expression of endogenous or ectopically expressed human or mouse CD81 (A) or
SCARB1 (B) using appropriate antibodies. (C) Expression of human or mouse OCLN and
CLDN1 was determined by immunoblotting. Table S1 lists individual cell lines analyzed.
Figure S4. HCV RNA-replication in MLT-MAVS-/-miR-122 derived cell lines. Cell lines
analyzed in Fig. 5 were transfected with a subgenomic HCV reporter replicon and
replication was analyzed by luciferase assay at the indicated time points. Mean values
+SD from at least three independent experiments are given.
Figure S5. Infection of MLT-MAVS-/- miR-122 derived cell lines with HCVpp and HCVTCP.
(A) MLT-MAVS-/-miR-122 derived cell lines expressing either complete or minimal human
entry factors were infected with HCVpp of GT1a and GT2a. 48 h post infection cells were
lysed and luciferase activity was measured. (B) Cells in (A) were challenged with HCVTCP
and 48 h post infection luciferase activity was determined. Mean values +SD of three
independent experiments are shown.
Table S1 Derivatives of MLT- MAVS-/- cells. Novel cell lines were generated by lentiviral
transduction to stably express human miR-122, human or mouse ApoE and HCV entry factors. The
resistance gene encoded by the given vectors is indicated in brackets. Order of appearance
according to step-wise transduction. LV, empty vector; h, human; m, mouse; +, miR-122
expression
Transduced with
Cell line
(in order of transduction
MAVS-/-
mmmmm
hmmmm
hhhmm
hhhhh
mApoE
hApoE
LV
miR-122
-
and selection applied)
miR-122 (puromycin N-acetyl+
+
+
+
+
+
+
+
LV
h
m
h
h
h
m
h
h
m
m
h
h
m
m
h
m
m
m
h
m
m
m
transferase)
ApoE (blasticidin S deaminase)
OCLN (neomycin phosphotransferase)
CD81 (blasticidin S deaminase) + FACS
sorted
CLDN1 (blasticidin S deaminase)
SCARB1 (neomycin
phosphotransferase)
References
1.
Michallet MC, Meylan E, Ermolaeva MA, Vazquez J, Rebsamen M, Curran
J, Poeck H, et al. TRADD protein is an essential component of the RIG-like
helicase antiviral pathway. Immunity 2008;28:651-661.
2.
Muller U, Steinhoff U, Reis LF, Hemmi S, Pavlovic J, Zinkernagel RM,
Aguet M. Functional role of type I and type II interferons in antiviral defense.
Science 1994;264:1918-1921.
3.
Sato M, Suemori H, Hata N, Asagiri M, Ogasawara K, Nakao K, Nakaya T,
et al. Distinct and essential roles of transcription factors IRF-3 and IRF-7 in
response to viruses for IFN-alpha/beta gene induction. Immunity 2000;13:539-548.
4.
Carlson CM, Frandsen JL, Kirchhof N, McIvor RS, Largaespada DA.
Somatic integration of an oncogene-harboring Sleeping Beauty transposon models
liver tumor development in the mouse. Proc Natl Acad Sci U S A 2005;102:1705917064.
5.
Tward AD, Jones KD, Yant S, Cheung ST, Fan ST, Chen X, Kay MA, et al.
Distinct pathways of genomic progression to benign and malignant tumors of the
liver. Proc Natl Acad Sci U S A 2007;104:14771-14776.
6.
Koutsoudakis G, Kaul A, Steinmann E, Kallis S, Lohmann V, Pietschmann
T, Bartenschlager R. Characterization of the early steps of hepatitis C virus
infection by using luciferase reporter viruses. J Virol 2006;80:5308-5320.
7.
Steinmann E, Brohm C, Kallis S, Bartenschlager R, Pietschmann T.
Efficient trans-encapsidation of hepatitis C virus RNAs into infectious virus-like
particles. J Virol 2008;82:7034-7046.
8.
Pietschmann T, Kaul A, Koutsoudakis G, Shavinskaya A, Kallis S,
Steinmann E, Abid K, et al. Construction and characterization of infectious
intragenotypic and intergenotypic hepatitis C virus chimeras. Proc Natl Acad Sci U
S A 2006;103:7408-7413.
9.
Bitzegeio J, Bankwitz D, Hueging K, Haid S, Brohm C, Zeisel MB,
Herrmann E, et al. Adaptation of hepatitis C virus to mouse CD81 permits infection
of mouse cells in the absence of human entry factors. PLoS Pathog
2010;6:e1000978.
10.
Narbus CM, Israelow B, Sourisseau M, Michta ML, Hopcraft SE, Zeiner GM,
Evans MJ. HepG2 cells expressing microRNA miR-122 support the entire hepatitis
C virus life cycle. J Virol 2011;85:12087-12092.
11.
Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L. A
third-generation lentivirus vector with a conditional packaging system. J Virol
1998;72:8463-8471.
12.
Kalajzic I, Stover ML, Liu P, Kalajzic Z, Rowe DW, Lichtler AC. Use of VSVG pseudotyped retroviral vectors to target murine osteoprogenitor cells. Virology
2001;284:37-45.
13.
Lindenbach BD, Evans MJ, Syder AJ, Wolk B, Tellinghuisen TL, Liu CC,
Maruyama T, et al. Complete replication of hepatitis C virus in cell culture. Science
2005;309:623-626.