Supplementary Materials and Methods
Cell culture, transfections, and RNA interference
Cells used in this study were maintained in DMEM supplemented with 10% heatinactivated fetal bovine serum. HeLa and HEK293T cells were from the ATCC. The 786-O G7F
cell line was made through transduction of the 786-O VHL-negative RCC cell line with a
retrovirus construct expressing VHL cDNA with a FLAG epitope tag at the C-terminus. The
WT7 and WT8 RCC cell lines were a gift of Dr. William Kaelin, Dana-Farber Cancer Institute.
Cell culture under 1% oxygen levels (hypoxia) was performed in a dedicated 37°C
chamber monitored by a BioSpherix C21 dual O2/CO2 controller (Lacona, NY) calibrated
according to the manufacturer’s instructions. Cells were seeded in 100 mm tissue culture
dishes and cultured in 5% CO2 in normoxia (room air) for 24 h before transferring to the hypoxia
chamber (1%O2/5%CO2). For pulse-chase experiments cells were cultured in 60 mm tissue
culture dishes to 75% confluence. After a 30 min incubation in methionine-free medium
containing 5% dialyzed fetal bovine serum, 35S-methionine/cysteine (Easy Tag Express, Perkin
Elmer) was added (0.5 mCi/plate; 2 ml final volume). In hypoxia experiments the 30 min pulse
labeling was performed in room air at which point the labeling medium was replaced with
medium containing cold methionine and dishes were either maintained in room air or were
transferred to the hypoxia chamber. Lysates were prepared in RIPA buffer at the indicated time
points and evaluated by immunoprecipitation.
Transfections were performed in Opti-MEM (Invitrogen) using Lipofectamine 2000
(Invitrogen) according to the manufacturer's instructions. siRNAs were custom synthesized by
Dharmacon. The sequence for Cdh1 siRNA-1 was 5'-AATGAGAAGTCTCCCAGTCAGdTdT-3'
(dT, deoxyribosylthymine) (Liu et al., 2008) and Cdh1 siRNA-2 was 5'AAAACGATGTGTCTCCCTACTCC dTdT-3' (Wei et al. 2004). Cells were transfected with 1 M
specific siRNAs or randomized cocktails of double-stranded RNA as a control, with the use of
1
the Lipofectamine 2000 reagent (Invitrogen). At 24 hr post-transfection, cells were transfected
again with the same siRNA preparations to ensure efficient depletion.
Western Blotting and real-time RT-PCR
For Western blot analysis, cells were lysed in 100 mM Tris-Cl, pH 8, 10 mM EDTA, 150 mM
NaCl, 1% Nonidet P-40, 1 mM PMSF, 2 mM NaF, 1 mM Na3VO4 and supplemented with
protease inhibitor cocktail (Roche). Sixty g of total protein was loaded per lane for SDS-PAGE
and western blotting in order to detect pVHL. For other proteins detected in this study 30 g of
total protein per lane was loaded. Loading equivalency was determined by Ponceau S staining
of membranes immediately after transfer as well as with anti--tubulin blotting.
Total RNA was extracted by Trizol and 1 g of total RNA was used for cDNA synthesis
(Invitrogen). Primers for VHL, VEGF, and 18S rRNA cDNA amplification were from Qiagen.
Quantitative PCR analysis was performed in an ABI StepOnePlus Real-Time PCR system using
SYBR green for detection. VHL and VEGF levels were determined relative to 18S rRNA, and
the PCR data were analyzed with the ABI StepOne software package.
Protein-protein interactions
For immunoprecipitations, cells were lysed with NP-40 buffer (50 mM Tris, pH 7.4, 150 mM
NaCl, 1 mM EDTA, 1% Nonidet P-40, 30% glycerol, 1mM PMSF, 2 mM NaF, 1 mM Na3VO4,
and protease inhibitor cocktail (Roche)). Lysates were incubated with various antibodies
overnight at 4°C and captured with Protein A/G beads. Complexes were washed three times
with lysis buffer and twice with cold PBS, resolved on 12% gels, and analyzed by western
blotting. Talon metal affinity resin (Clontech) pull down assays cells were performed using
Talon extracts (20 mM Tris, pH 8.0, 10% glycerol, 300 mM NaCl, 0.5% Nonidet P-40, 0.5%
2
Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail). Bound complexes were
washed with Talon buffer, resolved on 12% gels, and analyzed by western blotting.
3