Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO and National Reference Laboratory for Avian Influenza
IZSVe LABORATORY MANUAL
FOR THE DIAGNOSIS OF AVIAN INFLUENZA
Molecular Techniques
(for internal laboratory use only)
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
2
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
INDEX
1. INTRODUCTION ....................................................................................................................................... 5
1.1Aetiology ................................................................................................................................................. 5
2. MOLECULAR DETECTION OF AVIAN INFLUENZA VIRUSES .................................................... 6
2.1 Introduction and basic terminology ............................................................................................................. 6
2.2 Extraction of RNA.................................................................................................................................. 6
2.3 The Polymerase Chain Reaction in brief ................................................................................................ 7
2.4 Components of the PCR reaction ........................................................................................................... 8
2.5 The cycling reaction ............................................................................................................................... 9
2.6 Limitations............................................................................................................................................ 11
2.7 The real time PCR in brief.................................................................................................................... 12
2.8 Detection and analysis of the reaction product in Conventional PCR: ................................................ 13
2.9 Organization of the laboratory for molecular diagnostics .................................................................... 15
2.10 How to prepare reaction mix for PCR ................................................................................................ 16
Annex A .......................................................................................................................................................... 17
1.Fixing solution for acrilamide gel ........................................................................................................... 17
2. Silver Nitrate 0,4% for acrilamide gel .................................................................................................. 17
3. Developing solution for acrilamide gel .................................................................................................. 17
4. Acetic Acid 5% ..................................................................................................................................... 17
5. Acrylamide solution 7% ......................................................................................................................... 18
6. APS (ammonium persulfate) 10% .......................................................................................................... 18
7. TBE 10X................................................................................................................................................. 18
8. Gel loading buffer 10X........................................................................................................................... 18
9. Marker .................................................................................................................................................... 19
10. TAE 10X .............................................................................................................................................. 19
Annex B .......................................................................................................................................................... 20
1. ACRYLAMIDE GEL ............................................................................................................................. 20
2. AGAROSE GEL .................................................................................................................................... 21
1.1 Samples: ............................................................................................................. 23
1.2 RNA extraction .................................................................................................... 23
AnnexD ........................................................................................................................................................... 24
1. Detection of type A influenza virus by One Step RT-PCR (M gene) .................................................... 24
1.2 One step RT-PCR (AB 9700 thermal cycler) (Applied Biosystems GeneAmp Gold RNA PCR
Core Kit Part.No 4308207) .......................................................................................... 24
Primers: (Detection of AIV from different species by PCR Amplification of conserver sequenced in the
matrix gene. Fouchiers, Bestevroer, Herfst, van der Kemp, Rimmelzwaan, Oeterhaus. Jurnal of clinical
microbiology. Nov 2000 ) ............................................................................................................................... 24
Annex E ........................................................................................................................................................... 25
Detection of type A influenza virus by REAL TIME One Step RT-PCR (M gene) .................................. 25
One step RT-PCR (AB 9700 thermal cycler) (QuantiTect Multiplex RT-PCR kit 2X) .................. 25
Annex F .......................................................................................................................................................... 26
1. PROTOCOL FOR THE DETECTION OF H5 AVIAN INFLUENZA VIRUS USING
CONVENTIONAL RT-PCR...................................................................................................................... 26
1.1 Background ......................................................................................................... 26
1.2 Sensitivity & specificity .......................................................................................... 26
1.3 H5KHA OneStep RT-PCR: .......................................................................... 26
H7GK OneStep RT- PCR: .................................................................................. 28
AnnexG ............................................................................................................................................................ 29
H5-H9 OneStep real time RT- PCR: .................................................................. 29
Primers: H5F ................................................................................................................................................. 29
3
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Primers: H5NE-R .......................................................................................................................................... 29
Primers: H9F ................................................................................................................................................. 29
Primers: H9R ................................................................................................................................................. 29
H7GK OneStep RT- PCR: .................................................................................. 30
Primers: H7F ................................................................................................................................................ 30
Primers: H7R deg ......................................................................................................................................... 30
Ultra pure water ............................................................................................................................................ 30
3.SAFETY AND PROCEDURAL RULES IN A BIOMOLECULAR LABORATORY………………31
4
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
1. INTRODUCTION
1.1 Aetiology
Influenza viruses are segmented, negative strand RNA viruses belonging to Orthomyxoviridae family. Four
different genera are know: Influenzavirus A, B and C and Thogotovirus, but only the first ( influenza A
viruses) can cause the disease in avian species. Influenza type A viruses are further divided into subtypes on
the basis of two different surface antigenic glycoproteins: the haemagglutinin (HA) and the neuraminidase
(NA). At present, 16 HA subtypes (H1-H16) and nine NA subtypes (N1-N9) are recognised.
Each virus has one H and one N antigen type, virtually in any combination. All subtypes and the majority of
possible combinations have been isolated from avian species.
Highly Pathogenic Avian Influenza (HPAI):
Influenza A viruses infecting poultry can be divided into two distinct groups on the basis of the severity of
the disease they cause. The very virulent viruses cause Highly Pathogenic Avian Influenza (HPAI), a
systemic infection, in which flock mortality in some susceptible species may be as high as 100%. These
viruses have been individuated as some strains belonging to the H5 and H7 subtypes exhibiting a multi-basic
cleavage site at the precursor of the haemagglutinin molecule. HPAI is a dead-end infection in certain
domestic birds (eg. chickens and turkeys) and has a variable clinical behaviour in domestic waterfowl and in
wild birds, in which it may or may not cause clinical signs and mortality. To date the potential role as
reservoirs of infection of wild birds and waterfowl has been described only for the Asian HPAI H5N1 virus.
The ecological and epidemiological implications of this unprecedented situation are not predictable.
Low Pathogenicity Avian Influenza (LPAI):
On the other hand, viruses belonging to all subtypes (H1-H16), lacking the multi-basic cleavage site, are
perpetuated in nature in wild bird population. Feral birds, particularly waterfowl represent the natural hosts
for these viruses and are therefore considered an ever-present source of viruses. Following introduction into
domestic bird populations, these viruses cause low pathogenicity avian influenza (LPAI). This is a localised
infection, resulting in a mild respiratory disease, depression and decrease in egg production in laying birds.
Current theories suggest that HPAI viruses emerge from H5 and H7 LPAI progenitors by mutation or
recombination although there must be more than one mechanism by which this occurs. This is supported by
phylogenetic studies of H7 subtype viruses, which indicate that HPAI viruses do not constitute a separate
phylogenetic lineage or lineages, but appear to arise from non-pathogenic strains and the in vitro selection of
mutants virulent for chickens from an avirulent H7 virus. It appears that such mutations occur only after the
viruses have moved from their natural wild bird host to poultry. However, the mutation to virulence is
unpredictable and may occur very soon after introduction to poultry, or after the LPAI virus has circulated
for several months in domestic birds.
5
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
The scientific evidence collected in recent years, leads to the logical conclusion that not only HPAI viruses
must be controlled in domestic populations but also LPAI viruses of the H5 and H7 subtypes, as they
represent HPAI precursors. For this reason, both HPAI and LPAI belonging to H5 and H7 subtypes are
considered by OIE (World Health Organisation for Animal Health) as notifiable diseases.
2. MOLECULAR DETECTION OF AVIAN INFLUENZA VIRUSES
2.1 Introduction and basic terminology
In the last decade there have been developments in the application of molecular methods for the detection
and characterisation of AI viruses directly from clinical specimens of infected animals. In addition, based on
the current definition of HPAI, the molecular techniques can be considered a valid and official tool to
identify virulence factors and to confirm the presence of HPAI viruses in laboratory specimens.
The vast majority of the molecular detection methods for AI are based on the retro-transcription (RT)
of a selected segment of the viral RNA genome into a copy of a DNA molecule (cDNA) followed by the
amplification of this cDNA molecule by the Polymerase Chain Reaction (PCR) principle. The whole
process is therefore known as RT-PCR.
Conventional RT-PCR protocols, consisting in RT-PCR amplification followed by gel electrophoresis of the
amplified products, directly applied on clinical material could result in rapid detection of type A avian
influenza viruses and/or in rapid identification of the influenza subtype (at least for H5 and H7).
Furthermore, the amplified cDNA can be directly sequenced allowing an extremely rapid characterization
and pathotyping of the virus involved in an epidemic.
The recent introduction of real time RT-PCR (rRT-PCR) techniques for the detection of AI RNA has lead to
an even more rapid, sensitive and sometimes specific detection of the viral genome in clinical samples.
2.2 Extraction of RNA
Influenza viral genome is constituted by negative single stranded RNA, ribonucleic acid, that can be
extracted from a variety of specimens (blood, organs, tissues, faeces, swabs, etc) of infected animals. The
most important factor to consider during RNA manipulation is the chemical stability of this molecule, that is
minor than DNA. RNA has to be handle carefully, to avoid degradation or damage. RNase, the enzyme that
degrades RNA, is ubiquitarian. It is important to handle RNA with disposable gloves and using tools, as tips
and tubes, Rnase-free. The use of DEPC (Diethyl Pyrocarbonate) or RNAse-free water is also strongly
recommended. Another important factor to consider is the storage temperature for samples and extracted
RNA. RNA must be store at -80°C or in liquid nitrogen to preserve it from degradation.
6
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
In diagnostic laboratories the extraction of RNA is commonly performed by commercially available kits. The
major advantages of using commercial kits are: the better standardization of the procedure, the high sample
throughput and the possibility to robotize the extraction procedure. By using kits the procedure is less time
consuming and laborious compared to classical manual procedures. Also, a reduced volumes or the absence
of hazardous chemical compounds are common features of many commercial kits. The main limitation
consists in the relatively higher cost of the kits.
It is important to keep in mind that RNA extraction is a delicate procedure that have great influence
on the whole molecular diagnostic process. Failures at this stage will result in inconsistent or false
results (both false negatives or false positives).
2.3 The Polymerase Chain Reaction in brief
The PCR provides an extremely sensitive means of amplifying specific sequence of DNA. The principle is
simple: a specific fragment of DNA is repeatedly synthesized using the DNA polymerase I enzyme derived
from the bacterium Thermus aquaticus (Taq). This organism lives in hot springs and many of its enzymes,
including the polymerase, are resistant to thermal denaturation. The thermostability of the Taq polymerase is
an essential feature for PCR methodology.
Any region of any DNA molecule (including the cDNA derived from RT reactions) can be chosen, so long
as the sequences at the borders of the region of interest are known. This technique has rapidly become one of
the most widely used techniques in molecular biology: it is a rapid, versatile, inexpensive and simple means
of producing relatively large numbers of copies of DNA molecules (by several million fold or more) from
minute quantities of source DNA material, even when the source DNA is of relatively poor quality. The
development of this technique resulted in an explosion of new techniques in molecular biology as more and
more applications of the method were published; it can be used for diagnostic tests, DNA fingerprinting,
DNA sequencing, screening for genetic disorders, site specific mutation of DNA, cloning or subcloning of
cDNAs, and other applications.
Many types of samples can be analysed for nucleic acids. Many PCR protocols use DNA as a target, rather
than RNA, because of the stability of the DNA molecule and the ease with which DNA can be isolated.
However, it is possible to start from RNA, providing that this molecule is first transcribed into cDNA. The
copy DNA is then used as template in a subsequent PCR reaction (RT-PCR reaction). By following a few
basic rules, problems can be avoided in the preparation of DNA/RNA for the PCR. The essential criteria for
a sample processed by PCR is that it should contain at least few copies of intact RNA/DNA strand
encompassing the region to be amplified and that any impurities are sufficiently diluted so as not to inhibit
the polymerisation step of the PCR reaction.
7
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
2.4 Components of the PCR reaction
The reagents needed to perform a PCR reaction are the following:

Primers (Forward and Reverse)

dNTPs

Taq polymerase buffer

Taq polymerase

MgCl2

ddH2O
Primers:
A primer is a short segment of nucleotides which is complementary to the flanking sequences of the DNA
segment (template) which is to be amplified in the PCR reaction. For a PCR reaction two primers (forward
and reverse) are required, each complementary to one strand (indicated as 3’-5’ and 5’-3’) of the double
helix of the DNA. Primers are annealed to the denatured DNA template to provide an initiation site for the
elongation of the new DNA molecule by Taq polymerase.
Primer design is extremely important for effective amplification. The primers for the reaction must be very
specific for the template to be amplified. Cross reactivity with non-target DNA sequences results in nonspecific amplification of DNA and, at the end, in false positive results. Also, the primers must not be
capable of annealing to themselves or to each other, as this will result in the very efficient amplification of
short nonsense DNA molecules and inefficient amplification of the specific target DNA.
dNTPs
The four nucleotide bases, the building blocks of every piece of DNA, are represented by the letters A, C, G,
and T, which stand for their chemical names: Adenine, Cytosine, Guanine, and Thymine. The A on one
strand always pairs with the T on the other, whereas C always pairs with G. The two strands are said to be
complementary to each other. The dNTPs are incorporated in the newly synthesized strand by Taq
polymerase according to the template strand.
Taq polymerase buffer:
This reagent is necessary to create the optimal chemical conditions for the activity of the Taq polymerase.
Taq polymerase
The polymerase recognizes the primer-template duplex and begins adding nucleotides to the primer and
makes a complementary copy of the template. If the template contains an A nucleotide, the enzyme adds on a
T nucleotide to the primer. If the template contains a G, it adds a C to the new chain, and so on to the end of
the DNA strand.
8
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Magnesium Chloride (MgCl2)
This reagent is crucial for the activity of Taq polymerase because is the catalyst of the reaction of enzyme.
Distilled water (ddH2O)
To dilute the reagent at the correct concentration and to reach the reaction volume. Water should be sterile,
free of salts and ions and, for RT-PCR methodology, it is essential to use Rnase-free water to avoid
degradation of the RNA molecule.
2.5 The cycling reaction
There are three major steps in a PCR, which are repeated 30 to 40 times (cycles) (Fig 1). The reaction is done
in an automated thermal cycler, which can heat and cool the tubes containing the reaction mixture in a very
short time.
Most of the common PCR protocols will follow the scheme indicated below.

Denaturation
at
94-95°C
from
30
seconds
to
1
minute:
During the denaturation, the double strand melts open to single stranded DNA, all enzymatic
reactions stop (for example: the extension from a previous cycle).

Annealing
at
X°C
from
30
seconds
to
2
minutes:
The primers in the solution are continuously forming and breaking ionic bonds with the single
stranded template. The more stable bonds last longer (primers that fit exactly) and the polymerase
will bound at that short double-stranded DNA, starting copying the template. The temperature at
which this will happen is the annealing temperature. The temperature depends on the primers
sequence, but it commonly ranges between 35° and 60°C.

Extension at 72°C from 30 seconds to X minutes (this data depends on the length of the amplified
fragment, usually 1 minute for 1 Kb).
This is the ideal working temperature for the polymerase. The bases (complementary to the
template) are coupled to the primer on the 3' side (the polymerase adds dNTP's from 5' to 3', reading
the template from 3' to 5' side, bases are added complementary to the template)
9
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Fig 1: example of standard PCR cycle
The entire process of amplification by PCR takes 2 to 4 hours, depending on the number of cycles and on the
time of the different steps. In theory, during the PCR reaction, one single copy of the target sequence can be
amplified exponentially. In each cycle the amount of amplified fragment is doubled, thus the correlation
factor/ratio between the number of cycle and the amount of amplified fragment is 2 n where n = cycles
number. Starting form 1 single target fragment, after one cycle, the number of amplified fragment will be 21
= 2, after two cycles 22 = 4, after three cycles 23 = 8, and so on. After 36 cycles the number of amplified
fragment will be 68 billion copies (Fig 2).
See Appendix C and F for conventional RT-PCR protocol on avian influenza.
10
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Fig 2: exponential amplification in PCR reaction
2.6 Limitations
As many other laboratory methods, conventional PCR has some limitations. Sequence-specific primers are
required, meaning that the DNA sequence of the region flanking the amplified DNA should be known.
To visualize the result of the assay and to check for its specificity it is necessary to perform a gel
electrophoresis analysis, that is a relatively time consuming method and might expose the operator to
chemical hazards.
The reaction is limited in the size of the DNAs to be amplified (i.e., the distance apart that the primers can be
placed). The most efficient amplification is in the 300 - 1000 bp range, however amplification of products up
to 4 Kb has been reported.
One of the most important factor to consider during PCR diagnostics is contamination. If the sample that is
being tested has even the smallest contamination by target DNA of exogenous origin, this DNA will be
amplify, resulting in a false positive detection. Post amplification sample handling can also be considered
critical with regard to environmental and samples contamination. The huge amount of amplified target DNA
molecules can be easily spread to the laboratory environment and to other samples during the manipulation
of the tubes for gel detection.
To reduce the impact of some of the above listed limitations of the conventional PCR, a newly PCR
methodology has been developed, the real time PCR (rPCR, from DNA; rRT-PCR, from RNA).
11
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
2.7 The real time PCR in brief
In a standard polymerase chain reaction the amount of product generated should, theoretically, double with
each additional cycle. If that were really how it worked, then the amount of product present at the end would
be a simple function of the amount of template present at the beginning. However, it doesn’t work that way
in real life. As the reaction progresses primers and nucleotides are consumed and eventually become
limiting,
so
the
efficiency
per
cycle
starts
to
drop
off
at
some
point.
Real Time PCR can provide a quantitative relationship between the amount of template initially present and
the amount of product formed because it provides a way of measuring the amount of product formed during
each individual cycle using a fluorescent reporter dye of some sort. This fluorescence reporter can be linked
to a probe (short oligonucleotide that is complementary to a target sequence located between the primers), or
can be a fluorescence molecule that is able to link double stranded DNA (es. SybrGreen®). Different probes
are available on commerce: hydrolysis probes (es. TaqMan probes); hybridization probes (FRET); molecular
beacons; PNA Peptide Nucleic Acid; MGB (Minor Groove Binding). Despite the difference among these
chemistries, the basic principle is to measure the fluorescence signal (and then the amplified fragment
concentration) at the end of each PCR extension step and plot the data. The plot will be sigmoidal, flat at the
baseline level for the first 10-20 cycles (exponential phase) while the amount of template initially
accumulates to the point where the fluorescence signal becomes detectable. Then the plot rises linearly for
several cycles (linear phase) and finally begins to “roll over” and then becomes almost flat (plateau phase).
Only in the linear range you can assume that there is a direct relationship between the amount of template
present in the reaction and the intensity of the fluorescence signal. These measurements have to be made
while the PCR is in progress, so this is called a “real time” measurement rather than an end point
measurement. Thus the name real time PCR (Fig 3).
12
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
F
L
U
O
R
E
S
C
E
N
C
E
Threshold line
Fig 3: Schematic view of amplification plot in rPCR
See Appendix D,E,G,H for real time PCR protocols for avian influenza at the end of this chapter.
2.8 Detection and analysis of the reaction product in Conventional PCR:
The final PCR product (also known as amplicon) should be fragments of cDNA of defined length. The
simplest way to check for the presence of these fragments is to load a sample taken from the reaction product
(generally few microliters), along with appropriate molecular-weight markers, onto an agarose (which
contains 0.8-4.0% ethidium bromide) or polyacrilamide gel. DNA bands on the agarose gel can then be
visualized under ultraviolet trans-illumination (Fig 4). For acrylamide gel the bands can be visualized by
silver staining. By comparing product bands with bands from the known molecular-weight markers, you
should be able to identify any product fragments which are of the appropriate molecular weight.
This system to visualize the bands is called gel-electrophoresis.
13
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Fig 4: agarose gel detection of PCR amplicons
Gel-Electrophoresis
Electrophoresis is the separation of DNA fragments into different sizes through a matrix of agarose or
acrylamide inside an electrophoresis chamber. The chamber has two electrodes on opposite ends, which can
be attached to a AC power supply. An appropriate electrophoresis buffer fills the chamber and conducts the
electricity between two electrodes. When current is applied, the negatively charged DNA migrates toward
the positive electrode. The matrix of gel (agarose or acrylamide) acts as a sieve, allowing the smaller-sized
fragments to migrate faster than the larger fragments, thus separating fragments by size. The main difference
between agarose and acrylamide gel is the size of the network. The speed of electrophoresis is dependent on
the size of the gel and the amount of voltage applied to the gel box by the power supply. The higher the
voltage, the faster the migration of the fragments. Each gel box has a maximum optimal voltage range, and
exceeding this range results in smearing of the DNA bands. Lower voltages generally give cleaner separation
of bands. After electrophoresis, view the DNA by staining with ethidium bromide or SyBrGreen® for agarose
gels and silver nitrate staining for acrylamide gels. Ethidium bromide is the stain most commonly used by
diagnostic laboratories because of its sensitivity to DNA and the speed of staining. Drawbacks include the
cost involved for its visualization (it requires a UV light source), and its suspected carcinogenicity. However,
working with appropriate PPI (lab-coats, disposable gloves), the low concentrations required for staining can
be used safely.
Silver stained acrylamide gels are considered more sensitive, allowing the visualization of smaller amounts
of amplicons. The smaller size of the acrylamide gel network leads to a better separation of the amplicons,
particularly of small size (e.g. 50-200 bp). These features will contribute to increase the sensitivity and the
specificity of the PCR protocol. In addition, expensive visualization equipments are not required.
Drawbacks include the use of toxic compounds (as silver nitrate and acrylamide) and the longer time
requested to set up and run the gel compared to agarose. See Appendix A and B for formulas and protocols.
14
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
2.9 Organization of the laboratory for molecular diagnostics
Due to the high sensitivity of the method and the high sample workflow of a PCR diagnostic laboratory, the
risk of samples cross-contamination must be seriously taken into account.
Following, some indications and examples are provided on how a PCR laboratory should be structured in
order to limit these problems.
Considering the whole PCR process, the minimal requirements would be to have 3 separate rooms, as the
example below.
First room: extraction of nucleic acid (DNA/RNA). Equipments needed:

Flow cabinet BL2.

Vortex

Centrifuge

Micropipettes

Thermal bath

Freezer -20°C

Freezer -80°C

+4°C refrigerator
In case nucleic acid extraction is performed using organic solvents, as phenol and chlorophorm, a fume hood
is required.
Second room: reaction mix preparation, all the reagents are mix together, without the template (DNA or
RNA):

Flow cabinet

Centrifuge

Vortex

Freezer -20°C (storage of the PCR reagents, primers and probes)
No samples and DNA/RNA templates should enter this room. Personnel entering this room should wear
dedicated lab-coats and gloves in order to avoid reagents contamination.
Third room: to add template nucleic acid to the reaction mix, to perform PCR and RealTime PCR reactions,
to visualize the PCR product on gel electrophoresis:

PCR cabinet (to add RNA or DNA)

Fume hood (for chemicals involved in gel electrophoresis)

Freezer -20°C

Refrigerator +4°C

Thermal cycler and/or
15
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza

RealTime PCR platform

Centrifuge

Vortex

Gel electrophoresis unit
2.10 How to prepare reaction mix for PCR

Before preparing the reaction mix is necessary to calculate the correct volumes of reagents to be
used, as in attached protocols (examples in Annex C and D). To ensure a homogeneous distribution
of the reagents in all the aliquots, it would be advisable to mix all the reagents in a single reaction
tube (master mix), then aliquot the necessary volume in the PCR tubes where the reaction for each
single sample will take place.

All the stock solutions of the reagents for PCR are stored at –20°C. It should be preferred to prepare
aliquots of the reagents stock solutions (particularly primers and probes), in order to avoid possible
contaminations of the stocks and minimize the damages in case contamination will occur. The
enzymes (reverse transcriptase, Taq) should be taken out of freezer ( –20°C) at the latest possible
moment, to maintain their shelf life.

All the volume will be added in an appropriate sterile vial.
The entire procedure to prepare the reaction mix is as following:

Thawing all the reagents, except for Taq polymerase and/or RT, possibly keeping them on ice.

Add the ddH2O volume

Add the Taq polymerase buffer volume

Add the MgCl2 volume

Add the dNTPs volume

Add the Primer Forward volume

Add the Primer Reverse volume

Add the Taq polymerase volume (and/or RT).

Vortex the solution

Distribute the single-reaction volume in separate sterile PCR tubes (as many as the number of
samples to be tested)

Add nucleic acid template on the flow cabinet in a separate room

Load the vials on the thermal blok of thermal cycler (or real time PCR platform) and start the
reaction.
16
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex A
1. Fixing solution for acrilamide gel
Per 1 liter solution
-
100 ml Methanol or Ethanol absolute
-
15 ml Nitric Acid 70%

Add 885 ml of ddH2O

Add nitric acid 70%

Add ethanol absolute or methanol
 Store at room temperature maximum 6 months
2. Silver Nitrate 0,4% for acrilamide gel
Per 500 ml solution
-
2 gr. Silver nitrate

Add Silver nitrate

Dissolve Silver nitrate in 500 ml of ddH2O

Filter the solution

Store maximum 6 months
3. Developing solution for acrilamide gel
Per 1 liter solution
-
30 gr. Sodium carbonate
-
700 µl Formaldehyde 36%

Dissolve sodium carbonate in 1 liter ddH2O

Store at room temperature maximum 6 months

At the first use add 700µl formaldehyde 36%
4. Acetic Acid 5%
Per 1 liter solution
-
50 ml pure glacial acetic acid (100%)

Add 950 ml ddH2O in a bottle

Add pure glacial acetic acid

Store maximum 6 months
17
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
5. Acrylamide solution 7%
Per 500 ml solution
-
50 ml TBE 10x
-
87,5 ml Acrylamide / bis acrylamide 29:1 40%
-
50 ml Glycerol 100%

Add acrylamide 40%

Add TBE 10X

Add glycerol 100%

Add 313 ml ddH2O

Store at room temperature maximum 1 year
6. APS (ammonium persulfate) 10%
For 10 ml solution
-
1 gr. Ammonium persulfate

Add ammonium persulfate in a 15 ml vial

Dissolve ammonium persulfate in 10 ml ddH2O

Store at room temperature maximum 1 year
7. TBE 10X
Per 1 liter solution
-
108 gr. Trizma base
-
55 gr. Boric Acid
-
40 ml EDTA 0,5M pH 8

Weight trizma base and boric acid

Dissolve the salts with EDTA in ddH2O and mix at room temperature

Add ddH2O to 1 liter volume
 Autoclave at 121°C for 20 minutes
 Store at +4°C maximum 1 year
8. Gel loading buffer 10X
Per 10 ml solution
-
0,2 gr. Ficoll
-
1 ml TBE 10X
-
6 ml Glycerol 100%
18
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
-
1 ml bromophenol blue and Xylene cyanol (0,5%)

Weight ficoll in a 15 ml vial

Add 1 ml TBE10X

Add 2 ml ddH2O

Dissolve the solution in a thermal bath at 37°C

Add glycerol

Add bromophenol blue and Xylene cyanol solution
 Store at +4°C maximum 1 year
9. Marker
For 800 µl solution
-
100 µl Marker (Roche)
-
300 µl gel loading buffer 10x
-
400 µl TBE 1X

Add Marker in a 1.5 ml vial

Add gel loading buffer

Add TBE 1X
 Store at +4°C maximum 1 year
10. TAE 10X
Per 1 liter
-
48,4 gr. Trizma base
-
11,4 ml glacial acetic acid
-
20 ml EDTA 0,5M pH 8

weight trizma base

Add glacial acetic acid

Dissolve the solution with EDTA , ddH2O at room temperature

Add ddH2O to 1 liter volume
 Autoclave at 121°C for 20 minutes

Store at +4°C maximum 1 year
19
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex B
1. ACRYLAMIDE GEL
1.1 Gel rack assembling

Clean with alcohol all the components (gel glasses, spacer, gel comb ecc).

Assembly the gel rack following manufacturer’s instructions
1.2 Gel preparation
Volumes for vertical gel (dimension 10cm x 7cm).


Mix the following reagents on a chemical flow cab :
-
5 ml acrylamide 7%;
-
20 l APS 10%;
-
10 l TEMED;
Load the solution in the gel rack assembled. Put the gel comb in the gel. Polymerization at room
temperature for 20 minutes
1.3 Sample loading and electrophoresis

Put the gel rack in the gel chamber. Fill in with TBE buffer

Mix the appropriate sample volume (usually 7 l) with 3-4 l of gel loading buffer;

Remove the gel comb;

Wash the wells with a syringe with TAE buffer

Load the samples and the appropriate marker in the gel

Close the gel chamber

Turn on the power supplier and set up the electrophoresis conditions (usually, for 7 % acrylamide:
40 minutes; 200V, 400 mA).

Connect the gel chamber to the power supplier and start the electrophoresis run
1.4 Gel staining

At the end of the run, turn off the power supplier, disassembly the gel chamber

Open the gel rack and put the gel in a tank

Cover completely the gel with fixing solution and shake for at least 5 minutes

Recover the fixing solution and cover completely the gel with ddH2O. Shake for 2 minutes

Discard the water and cover completely the gel with Silver nitrate solution, shake for 5 minutes
20
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza

Recover the silver nitrate solution and cover completely the gel with ddH2O. Shake for 2 minutes

Discard the water and cover completely the gel with developing solution, shake until bands become
visible

Discard the developing solution. Cover completely the gel with acetic acid solution and shake for at
least 5 minutes

Recover the fixing solution and cover completely the gel with ddH2O. Shake for 2 minutes

Seal the gel to make it easy to handle
2. AGAROSE GEL
2.1 Gel preparation

Weigh the correct agarose amount as in use protocol. The volume of the gel depends on the
dimension of the tank. To calculate it:
Gel tank width X Gel tank length X Gel thickness (0,5 cm )
Example 1:
10 cm X 7,5 cm X 0.5 cm = 37.5 ml TAE 1X =
0,375 g agarose (1% gel)
0,75 g agarose (2% gel)
Example 2:
8,5 cm X 7 cm X 0.5 cm = 30 ml TAE 1X =
0,3 g agarose (1% gel)
0,6 g agarose (2%gel)

Mix the agarose powder in the right volume of TAE buffer

Dissolve the agarose solution in microwave

Water-cool the solution until easy to handle

Gel staining by inclusion of Ethidium bromide; add 0,5μg / ml of Ethidium bromide and mix

Gel staining by final immersion in Ethidium bromide; proceed as following

Put the cooled solution in the gel tank prepared with comb. Avoid bubble air

Gel solidification at room temperature
2.2 Sample loading and electrophoresis

When solid, extract the comb from gel and put the gel (with tank) in a electrophoresis chamber

Mix the loading sample (es 5-10 l) with 3-4 l of gel loading buffer

Load the samples and the appropriate marker in the gel
21
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza

Close the gel chamber

Turn on the power supplier and set up the electrophoresis conditions: 90-100V, 30-40 minutes for
fragments between 100 and 1000 bp for 1 % Agarose gel.

At the end of electrophoresis:

a) Gel staining by inclusion of Ethidium bromide: put the gel with tank on a UV
transilluminator.

b) Gel staining by final immersion in Ethidium bromide : immerse the gel in a tank
with a 0,5-1 μg/ml solution of Ethidium. Shake for 20 minutes. Recover the
Ethidium solution (up to 20 staining) and cover completely the gel with ddH2O.
Shake for 20 minutes. Put the gel with tank on a UV transilluminator.

Detect the bands and save the image.
22
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex C
1.1 Samples:
Organs and tissues (cecal tonsils, trachea, lungs, intestine): extract the RNA from 200 μl of tissue
homogenate.
Cloacal swabs, tracheal swabs: dilute swabs in PBS (max 1 ml) and extract the RNA from 200 μl of
suspension. It is possible to pool the samples (10 tracheal swabs/pool or 5 cloacal swabs/pool).
Faeces: extract the RNA from 200 μl of suspension.
Allantoic fluid: extract the RNA from 200 μl of allantoic fluid.
1.2 RNA extraction
“Total Isolation Nucleospin RNA II “ Macharey Nagel”
Before starting:

Prepare ethanol 70%

Add absolute ethanol in the buffer RA3 solution

Add Rnase-free water to the ”rDNase Rnase- free” lyophilised
Extraction procedure:
Tissue lysis: add 300 µl of RA1 buffer with guanidinium to 100 µl of homogenised sample and vortex
Add 300 µl of ethanol 70 % to each eppendorf tube and vortex.
Place a Nucleospin column RAN II (light blue) in to the 2 ml elution tube. Dispense the sample (700 µl ) into
the appropriate column and centrifuge at 11.000g for 30 seconds.
Add 350 µl of MDB (membrane desalting buffer) and centrifuge at 11.000g for 1 minute.
Prepare the DNase reaction mixture in a sterile eppendorf tube: 10 µl of reconstituted DNase + 90µl of
reaction buffer for DNase.
Dispense 95 µl of this mixture into each column and incubate at room temperature for 15 minutes.
1° wash: add 200 µl of buffer RA2 to each column and centrifuge at 11.000g for 30 seconds. Discard the
flow trough
2° wash: add 600 µl of buffer RA3 to each column and centrifuge at 11.000g for 30 seconds. Discard the
flow trough
3° wash: add 250 µl of buffer RA3 to each column and centrifuge at 11.000g for 2 minutes to dry the
membrane. Discard the flow trough
RNA elution: put the column into a sterile new eppendorf tube, add 60 µl of RNase free water and
centrifuge at 11.000g for 1 minute.
23
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
AnnexD
Detection of type A influenza virus by One Step RT-PCR (M gene)
One step RT-PCR (AB 9700 thermal cycler) (Applied Biosystems GeneAmp Gold RNA PCR Core Kit Part.No
4308207)
Detection of type A RNA
Target: M gene
Sample: RNA 5 µl in 25 µl of total reaction volume
Primers: (Detection of AIV from different species by PCR Amplification of conserver sequenced in the matrix
gene. Fouchiers, Bestevroer, Herfst, van der Kemp, Rimmelzwaan, Oeterhaus. Jurnal of clinical
microbiology. Nov 2000 )

Forward M52C (5’- CCT CTA ACC GCG GTC GAA ACG - 3’)

Reverse M253R (5’ - AGG GCA TTT TGG ACA AAK CGT CTA - 3’)
REAGENT
CONCENTRAtion FINAL
l x 1 REAtion
Ultra pure ater RNA free
/
4.7l
PCR Buffer 5X
1X
5 l
MgCl2 25mM
2.5 mM
2.5 l
dNTPs Mix 10mM
1 mM
2.5 l
DTT 100 mM
10 mM
2.5 l
Primer M-F 10 M
0,3 M
0.75 l
Primer M-R 10 M
0,3 M
0.75 l
RNase Inhibitor 20U/l
10U
0.5 l
Reverse Transcriptase 50U/l
15U
0.3 l
Ampli Taq GOLD 5U/l
2.5 U
0.5 l
TOTAL VOLUME
20l
sample RNA
5l
FINAL VOLUME
25l
l TOTAL
Amplification cycle :
42°C
95°C
94°C
5min
1 min
20min
55°C
1 min
40 cicli
72°C
72°C
1 min
10min
4°C

Detection: PAGE 7% - Silver staining or agarose gel 2% (NuSieve)
Expected amplified fragment: 240 bp
24
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex E
Detection of type A influenza virus by REAL TIME One Step RT-PCR (M gene)
One step RT-PCR (AB 9700 thermal cycler) (QuantiTect Multiplex RT-PCR kit 2X)
Primers (Spackman et al., 2002, J.Clin.Microbiol. 40:3256-3260):

Forward M+25 : AGA TGA GTC TTC TAA CCG AGG TCG

Reverse M-124 : TGC AAA AAC ATC TTC AAG TCT CTG
Probe (Spackman et al., 2002, J.Clin.Microbiol. 40:3256-3260):
 FAM M+64 : FAM-5’-tca ggc ccc ctc aaa GCC GA-3’ –TAMRA
FINAL CONCENTRATION
l x 1 REACTION
Probe FAM M+64 1 M
100nM
2.5l
Master Mix Taq Man 2X
1X
12.5 l
Primer M+25F 5M
300 nM
1.5 l
Primer M-124R 5M
300 nM
1.5 l
REAGENT
TOTAL l
0.2 l
Enxime mix
Bidistilled water
1.8 l
/
TOTAL VOLUME
20 l
Vortex the mix for few seconds.
Aliquote 20l per tube
RNA
5l
FINAL REACTION VOLUME
25 l
Cycling conditions:
50°C
95°C
94°C
15 min
45 sec
60°C
20 min
45 sec
40 cycles
4°C

25
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex F
1. PROTOCOL FOR THE DETECTION OF H5 AVIAN INFLUENZA VIRUS USING
CONVENTIONAL RT-PCR
1.1 Background
Two sensitive RT PCR protocols have emerged from the EU AVIFLU project. Here amplicons are detected
conventionally by agarose gel electrophoresis (2.5% NuSieve or similar) with ethidium bromide staining.
Both these amplicons span the HA cleavage site so sequencing can provide pathotyping information, ie LPAI
or HPAI. The two methods which utilise different primer pairs are known by their acronyms:

H5KHA PCR

GK7.3- GK7.4 PCR
These two conventional RT PCRs are applicable to the detection of current Eurasian H5and H7 isolates at
clinical levels. These include HPAI H5N1 isolates which have been circulating in poultry in the Far East
since 2003, this strain having now (October 2005) reached Romania and Turkey. In addition, other LPAI H5
strains isolated from European waterfowl within the past decade can also be detected by both H5 PCR
approaches.
1.2 Sensitivity & specificity
It is important to note the following when working with these two conventional H5 PCR approaches.
Results from VLA and from collaborating EU laboratories in the AVIFLU project have revealed the
following:

H5KHA PCR:
This appears to be highly sensitive, though some results have revealed possible specificity problems.
These include false positives with non-H5 AI specimens and / or multiple bands of similar size to the
predicted amplicon. This may relate to the precise cycling conditions which are employed on a
given make of thermocycler.
Therefore it may be appropriate to use both approaches for initial detection in a primary outbreak.
1.3 H5KHA OneStep RT-PCR:
This generates an amplicon of approximately 300-320bp for detection in agarose (Nusieve or similar, 2 –
2.5%) with ethidium bromide staining. The H5KHA primer pair is as follows:
H5-kha-1: CCT CCA GAR TAT GCM TAY AAA ATT GTC
26
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
H5-kha-3: TAC CAA CCG TCT ACC ATK CCY TG
Note the inclusion of degenerate nucleotides indicated above in bold.
Use the Qiagen OneStep RT-PCR kit (cat # 210212) to prepare 22.5l PCR volumes which include 1M
each primer & 5l RNA:
H5KHA OneStep RT-PCR
VOL (l)
REAGENT
FINAL CONCENTRATION
REQUIRED FOR
ONE REACTION
RNase-free water
PCR Buffer 5X from Qiagen OneStep
RT-PCR kit
dNTPs Mix 10mM (from Qiagen kit)
/
14.3 l
1X
5 l
0.4mM
1 l
1M
0.5 l
1M
0.5 l
8U
0.2 l
Primer H5-kha-1: 50 pmol/l
l
TOTAL
(50M)
Primer H5-kha-3: 50 pmol/l
(50M)
RNase Inhibitor 40U/l (Promega)
One Step RT-PCR Enzyme Mix
1 l
(Qiagen kit)
VOLUME MINUS TARGET
22.5 l
VOLUME EXTRACTED RNA
2.5l
FINAL REACTION VOLUME
25 l
H5KHA cycling conditions:
50°C
30min
94°C
94°C
15min
30 sec
58°C
68°C
68°C
1 min
7 min
1 min
4°C

40 cycles
NB: Note the above cave at concerning possible false positive results with this H5KHA PCR.
27
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
H7GK OneStep RT- PCR:
This generates an amplycon of approximately 200 bp for detection in 2% agarose
The GKHA primer pair is as follows:
H7-GK-7.3: ATGTCCGAGATATGTTAAGCA 3’
H7-GK-7.4: TTTGTAATCTGCAGCAGTTC 3’
Use the Qiagen OneStep RT-PCR kit (cat # 210212) to prepare 22.5l PCR volumes including 1M each
primer & 2,5l RNA:
H7-GK-HA OneStep RT-PCR
VOL (l) REQUIRED
REAGENT
FINAL CONCENTRATION
FOR ONE REACTION
TOTAL
(25l)
/
14.3 l
1X
5 l
0.4mM
1 l
Primer H7-F: 50 pmol/l (50M)
1M
0.5 l
Primer H7-R: 50 pmol/l (50M)
1M
0.5 l
8U
0.2 l
RNase-free water
PCR Buffer 5X from Qiagen
OneStep RT-PCR kit
dNTPs Mix 10mM (from Qiagen
kit)
RNase Inhibitor 40U/l
(Promega)
One Step RT-PCR Enzyme Mix
l
1 l
(Qiagen kit)
VOLUME MINUS TARGET
22.5l
VOLUME EXTRACTED RNA
2.5l
FINAL REACTION VOLUME
25 l
H7-GK-HA cycling conditions:
50°C
30min
94°C
94°C
15min
30 sec
52°C
45 sec
68°C
68°C
1 min
7 min
4°C

40 cycles
28
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
Annex G
Detection of subtype H5,H7,H9 avian influenza viruses by REAL TIME One Step RT-PCR
H5-H9 OneStep real time RT- PCR:
Reagents
Reagent name
Code/company
Storage conditions
Applied Biosystems
-20° C (+2-10)° C
cod. 450025
Applied Biosystems
-20° C (+2-10)° C
cod. 450025
Probe FAM H5
(5’-CCCTAGCACTGGCAATCATG-3’)
Probe FAM H9
(5’-TTCTGGGCCATGTCCAATGG-3’)
Primers: H5F
(5’-TTATTCAACAGTGGCGAG-3’)
Operon
Primers: H5NE-R
(5’-CCAKAAAGATAGACCAGC-3’)
Operon
Primers: H9F
(5’-ATGGGGTTTGCTGCC-3’)
Operon
Primers: H9R
(5’-TTATATACAAATGTTGCAYCTG-3’)
Operon
QuantiTect Multiplex RT-PCR kit 2X
Ultra pure water
-20° C (+2-10)° C
-20° C (+2-10)° C
-20° C (+2-10)° C
-20° C (+2-10)° C
Qiagen
cod. 204643
-20° C (+2-10)° C
/
RT/-20° C (+210)° C
Portocol
Reagent
Ultra pure water
Final concentration
/
300 nM
300 nM
1X
150 nM
Primer FOR
5M
Primer REV
5M
2x RT-PCR master mix
probe
1M
Enzyme mix
VOLUME TOTAL
Sample RNA
VOLUM FINAL
Reaction
Denaturation
RT
initial
50°C
95°C
20 min
15 min
l x 1 reaction
l TOTAL
0,55
1,5
1,5
12,5
3,75
0,2
20l
5l
25l
Denaturation
Annealing
94°C
45 sec
54°C
45 sec
40 cycles
29
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
H7GK OneStep RT- PCR:
Reagents
Nome reagente
Ditta/codice
Lotto
Modalità di
conservazione
Applied Biosystems
cod. 450025
-20° C (+2-10)° C
Primers: H7F
5’-TTTGGTTTAGCTTCGGG-3’
Operon
-20° C (+2-10)° C
Primers: H7R deg
5’-GAAGAMAAGGCYCATTG-3’
Operon
-20° C (+2-10)° C
Qiagen
cod. 204643
-20° C (+2-10)° C
Sonda VIC H7
CATCATGTTTCATACTTCTGGCCAT
QuantiTect Multiplex RT-PCR kit 2X
/
Ultra pure water
/
RT/-20° C (+2-10)° C
Protocol
REAGENTE
Ultra pure water
Mix probes + primers
2x RT-PCR master mix
CONCENTRAZIONE
FINALE
l x 1
REAZIONE
/
300nM H7F
900nM H7 deg
150nM probe
1X
4,8
l TOTALI
2,5
12,5
Enzyme mix
0,2
VOLUME TOTAL
Sample RNA
VOLUM FINAL
Reaction
RT
50°C
20 min
20l
5l
25l
Denaturation
initial
95°C
15 min
Denaturation
Annealing
94°C
45 sec
54°C
45 sec
40 cycls
30
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
3. Safety and procedural rules in a biomolecular laboratory
1. Purpose
This operative instruction illustrates the correct behaviour and approach when performing PCR and other
biomolecular procedures.
2. General Guidelines
2.1 Rules to follow when entering or leaving the laboratory.
Protective clothes such as lab coats and appropriate shoes must be worn before entering the laboratory and
should be removed in public spaces such as offices, meeting halls or bathrooms.
Hands must be washed with soap and water both before and after performing all experiments.
2.2 Rules In the laboratory
Staff should enter each laboratory section taking into account the one-way flow of work present in each of
them: from the PCR mix preparation room to the amplification room. For example technicians working in
the electrophoresis room shouldn’t move directly into the mix preparation room.
Reactive
preparation
room
Sample
preparation
room
Amplification and
electrophoresis
room
Extraction
room
2.2.1 PCR MIX preparation room
In this room the mixtures for PCR and for RRT-PCR are prepared.
The entrance door must always be closed.
Perform all the procedures under a laminar flow hood or a specific PCR safety hood.
Access to this section is forbidden to:
 samples, extracted nucleic acids, PCR amplicons, equipment, instruments and reagents used in other
rooms or for other purposs
Use disposable gloves and dedicated lab coats that should never leave this room.
Cloths from other rooms should not enter into the preparation room because of potential contamination
hazard.
31
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
All the reagents and the disposable equipments (e.g: tubes and tips) present in this room are devoted to PCR
mixture preparation. Specific tools (pipettes and microcentrifuge) should not be used for any other purpose.
The master mix must be dispensed into the microtubes in which the PCR will take place. Once the mix is
added, the microtubes will be closed and moved to another room for sample addition.
To avoid cross-contamination and damage due to continuous freeze and thaw, all reagents (primers, probes,
master mix and distilled sterile water) should be aliquoted and stored appropriately inside the PCR mix
preparation room. All information concerning the opening of new reagents packs, finishing or aliquoting
procedures should be registered in an appropriate form kept in the PCR Mix Room.
2.2.2 NUCLEIC ACID EXTRACTION ROOM
In this room nucleic acids are extracted from samples that will be subsequently tested, included positive and
negative process controls. This is the place with the highest biological hazard as all the infected samples are
collected and processed here. This room must contain biological safety cabinets and whenever possible, it
should be maintained under negative pressure.
The entrance door must be kept closed and appropriate personel protective items (PPI) must be worn inside.
Access to this section is forbidden to:
 reagents for master preparation;
 equipment, instruments and reagents used in other labs or for other purposes
From this room may exit only:
 tubes containing extracted nucleic acid (for other PCR laboratories);
 sample aliquots for all kinds of test.(for other laboratories)
Tubes or any other container that is dirty externally or with a defective seal are not allowed to leave the
room and must be eliminated or submitted
Use disposable gloves and devoted lab coats, which should never leave this room.
Clothing from other sections should not enter into the nucleic extraction room due to the potential
contamination hazard.
All reagents and disposable tools (tubes and tips) used for nucleic acid extraction must remain in this section.
It is forbidden to move specific equipment (e.g.pipettes) to other rooms and use them for other purposes.
Acid or organic solvents used while processing samples must always be used under a chemical safety hood
wearing specific PPI. Every operator working inside this room should wash his hands before leaving.
All information concerning the opening of a new reagent pack, finishing or aliquoting procedures should be
registered on an appropriate form kept in the room.
All the steps during sample preparation should be registered on appropriate schedule.
2.2.3 sample preparation for the pcr amplification Room
In this room the extracted nucleic acid (from section 2.2.2) is added to the master mix (prepared in section
2.2.1)
This procedure must be executed under a specific PCR safety hood
Access to this section is forbidden to:
 reagents for master preparation;
 equipment, instruments and reagents used in other rooms or for other purpose
From this room can exit only:
32
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease

Training in laboratory diagnosis for Avian Influenza
tubes containing extracted RNA and master mix destined for room 2.2.4;
Tubes originating from room 2.2.1 and room 2.2.2 must be perfectly closed, externally cleaned and marked
with the number of the sample to test.
Equipment (e.g. safety cabinets for PCR and pipettes) and consumables (e.g. tips and microtubes) must be
kept inside this room and must never be moved to other rooms or be used for different activities.
2.2.3.1 Sample preparation for Nested PCR amplification protocol.
When Nested PCR is correctly used the sensitivity and specificity of the assay increases highly due to the
numerous amplification cycles and to the double couple of primers instead of one.
When the samples resulting from the first PCR are transferred into the second (Nested) PCR tubes the carryover and the cross contamination hazard increases because of the huge amount of DNA copies, which could
be shed over the workplace.
In order to reduce contamination risks during sample preparation for the second amplification cycle it is
important to consider that:
- tubes must be open one by one ;
- when possible use two different termocyclers, (one for the first and a different one for the second PCR)
- use more than one negative control. During amplycon adding to the master mix a negative control should
be kept next to each tube or group of tubes (depending on how many sample are to be tested)
Negative controls from the first PCR will be included in the second PCR
2.2.4 Amplification AND DETECTION room
In this room the amplification of the nucleic acid by PCR is performed and its visualization by on gel
electrophoresis. (Whenever possible, a separate and specific room for gel detection would be optimal.)
All the procedures applied during the nucleic acid detection must be recorded on the appropriate form.
Access is forbidden into this section for the following reagents:
 reagents for master mix preparation;
 equipment, instruments and reagents used in other rooms or for other purpose
Items that can exit this section are:
 documentsrelated to the test results;
 photographic documents
The large amount of nucleic acid handled in this room increases significantly the contamination hazard. All
the necessary consumables and the reagents used for sample processing must always be set into this room.
Specific equipment must be never moved to other rooms or used for different activities. Nucleic acids
destined to further biomolecular investigations should never enter in this room.
Acrylammide and agarose gels are prepared in this room, thas chemical hazard are present , safety chemical
cabinet and specific PPI must be used.
3. consumables for PCR
33
Istituto Zooprofilattico Sperimentale delle Venezie
OIE/FAO National Reference Laboratory for Avian Influenza and Newcastle Disease
Training in laboratory diagnosis for Avian Influenza
These are represented by tips, tubes for samples, PCR tubes and disposable gloves. Each PCR room should
be provided with this equipment.Therse items should be specifically dedicatedto this room and never be
moved out.
3.1 Tips
 control the tips sterility. Tips must be RNase- e DNse-free.
3.2 Tubes
 tubes containing samples or reagents should be centrifuged to ensure contaminant material dropping
into the bottom and do not disperse from the cup when opening.
 manipulate the tubes from the outside surface and from the cap.
 make sure each tube is correctly identified.
3.3 Gloves
 disposable glove containers must be present in each room
 wear gloves of the correct measures to better control manipulations of materials and samples
 the operator must substitute the gloves with new ones each time he leaves a room and enters in a new
one or every time he suspects a glove contamination.
4. Laboratory housekeeping
Clean all the benches before and after work, with a diluted sodium hypochlorite solution (NaOCl 0,6 %) to
inactivating the pathogen agents and denaturing nucleic acids. In order to avoid bleach-damaged equipment,
rinse them after with ethanol 70% or an equivalent alcohol solution.
Alternatively, specific commercial products for nucleic acid removing may be used.
4.1 How to prepare the solution:
1. NaOCl 0,6 %. Commercial bleach diluted 1:10 into water.
Adjust the solution at pH 7.
2. Ethanol 70 %. Absolute alcohol ethylic 70 ml. Add distilled water until 100 ml.
4.2 How to use NAOCl 0,6 % and when:
1. Work tables (lab benches, hoods etc.) – daily, before and after use. Consider deactivating in bleach
when contamination is suspected.
2. Racks - always after use. Consider deactivating in bleach if contamination is suspected.
3. Pipettes: externally - before and after use. Consider deactivating in bleach if contamination is
suspected.
4. Thermocycler machines and centrifuges. Consider deactivating in bleach if contamination is
suspected.
Combs and gel supports must be clean with water after use.
34