Biotechnology Test Review Due March 4, 2015
Vocabulary (Must complete TWO vocabulary words)
Word
Restriction Enzyme
Definition
Diagram/Picture
Gel Electrophoresis
Plasmid
DNA Ladder
Recombinant DNA
Sticky Ends
Must complete FIVE of the below questions (Everyone must do #1)
1. What are some of the constraints or limitations on combining DNA from two different organisms?
Explain your reasoning.
2. Explain how restriction enzymes are used in genetic engineering and biotechnology.
3. What are some benefits of genetic engineering? What are some of the ethical issues raised by genetic
engineering and biotechnology?
4. Write down the following DNA strand:
a) ACTGACTCAGGAATTCATCGA
b) Write the complementary DNA strand directly below it, be sure to keep the base pairs lined up.
c) EcoRI cuts at the following site: G/AATTC. Cut the DNA with EcoRI
d) How many fragments will there be?
e) Label the sticky ends.
f) How many base pairs is each fragment?
5. Why are plasmids an important tool in genetic engineering research, provide three reasons.
6. Describe the process of DNA recombination. How is recombinant DNA (or GMOs) made?
7. How does a gel electrophoresis work? What information does gel electrophoresis provide?
8. When setting up a gel box for electrophoresis, which end do you put the comb at and why?
9. What is happening to the African Elephants? Explain how we used gel electrophoresis to help in
conservation of African Elephants.
10. DNA X and DNA Y are cut with EcoRI. DNA X has 3 fragments: 15bp, 20bp and 35bp. DNA Y has 4
fragments: 20bp, 50bp, 56bp and 75bp. Create a gel to show where these DNA fragments would
travel on a gel electrophoresis. Be sure to keep DNA X and DNA Y fragments in their correct lanes.