Appendix S1.Supplemental experimental procedures.
Preparation of constructs for evaluation of barley HGGT and Arabidopsis HPT transit peptides
The coding sequence for the N-terminal 49 amino acids of barley HGGT were amplified by PCR
using Pfu polymerase (Stratagene) using the forward and reverse oligonucleotides: 5’TTGAATTCATGCAAGCCGTCACGGCG-3’ (HvHGGT_TP.F) and 5’GAAAAGTTCTTCTCCTTTACTACTTTGGCACTGGCCTGCA-3’ (added restriction site is
underlined). Soluble GFP was amplified using the forward and reverse oligonucleotides: 5’TGCAGGCCAGTGCCAAAGTAGTAAAGGAGAAGAACTTTC-3’ and 5’AAGGATCCTTATTTGTATAGTTCATCCATGCC-3’ (sGFP.R). An aliquot of agarose gelpurified product from each reaction containing overlapping sequence homologies were combined
and re-amplified using primers HvHGGT_TP.F and sGFP.R. The product of the second reaction
was digested with EcoRI and BamHI and cloned into the corresponding sites of pART7,
downstream of the cauliflower mosaic virus 35S promoter. The cloned PCR product was
sequenced to confirm the in-frame fusion of the coding sequences for the N’-terminal 49 amino
acids of barley HGGT and soluble GFP. The same procedure was used for preparation of the
coding sequence for the fusion of the N-terminal coding sequence of Arabidopsis HPT with
GFP. The coding sequence for the N-terminal 36 amino acids of Arabidopsis HPT were
amplified with the forward and reverse oligonucleotides: 5’TTGAATTCATGGAGTCTCTGCTCTCT-3’ (AtHPT_TP.F) and 5’GAAAAGTTCTTCTCCTTTACTTGCGACAACTTTACTCGA-3’. GFP coding sequence was
amplified with the forward and reverse oligonucleotides: 5’TCGAGTAAAGTTGTCGCAAGTAAAGGAGAAGAACTTTTC-3’ and sGFP.R. A
seecondPCR reaction was conducted with the agarose gel-purified products using primers:
AtHPT_TP.F and sGFP.R. The product of this reaction was digested with EcoRI and BamHI
and ligated into pART7 and sequenced as described above. As a control, the coding sequence of
GFP without added N’-terminal sequence was amplified with the forward and reverse
oligonucleotides: 5’-TTGAATTCATGAGTAAAGGAGAAGAACTTTTC-3’ and sGFP.R. The
product of this reaction was digested with EcoRI and BamHI and ligated into pART7.
Synthesis of radiolabeled homogentisate
[U-14C]-hydroxyphenylpyruvate was prepared from [U-14C]-Tyr by reaction with amino acid
oxidase from Crotalusadamanteus venom (Sigma-Aldrich, Saint Louis, Missouri USA) as
described (Schulz et al., 1993), and then converted to [U-14C]-HGA (5 µM) by adjusting the
buffer to 50mMTris-HCl, pH 7.6, 78 mM KPO4, 4mM MgCl2, and 10 mMascorbate and
incubating with purified recombinant Arabidopsis hydroxyphenylpyruvatedioxygenase(50
μg/ml) for 1.5 hours. TLC analysis was used to verify that the reaction proceeded to completion.
The [U-14C]-HGA substrate was aliquoted and stored at -80° C.
Preparation of HGGT expression construct with DsRed selection for transformation of ggr
mutant
DsRed-GlyRed2-HGGT was prepared by PCR amplification of a barley HGGT cDNA
with forward and reverse oligonucleotides that contain added restriction enzyme sites
(underlined): 5’- TTGGATCCCGAGGATGCAAGCCGTCACGG -3’ and 5’TTCCATGGACACATCTGCTGGCCCTTGTAC-3’. Phusion polymerase (New England
Biolabs, Ipswich, MassachusettsUSA) was used for the PCR reaction. The reaction product was
digested withBamHI and NcoI and ligated into the corresponding sites of the vector AKK1517
(kindly provided by Dr. Christopher Taylor, DonaldDanforthPlantScienceCenter) downstream of
a super ubiquitin promoter and intron fromPinusradiata(Perera and Rice, 2002). AscI cassette
encompassing the promoter and 3’untranslated elements and the HGGT coding sequence from
this construct were cloned into the corresponding site of the binary vector DsRed-GlyRed2 that
contains a DsRed fluorescent marker for selection of transgenic seeds to generate DsRedGlyRed2-HGGT.
CPDL analysis of HGGT and HPT polypeptides
The Conserved Property Difference Locator (CPDL) program (Mayer et al., 2005) was used to
compare three HGGT sequences and ten HPT sequences. All sequences were obtained from
Genbank and accession numbers are given in the Supplemental data section. Amino acid
sequences were aligned using CLUSTALW (Version 2) with default parameters (Larkin et al.,
2007). Amino acid positions that were 100% conserved or which shared similar properties (size,
hydrophobicity, charge, polarity, aromaticity) in either HGGT or HPT sequences but which
differed between the two enzyme groups were flagged.
References
Larkin, M.A., Blackshields, G., Brown, N.P. et al. (2007) Clustal W and Clustal X version
2.0.Bioinformatics, 23, 2947-2948.
Perera, J.R. and Rice, S.J. (2002) Compositions and methods for the modification of gene
expression.United States Patent, 6,380,459.
Schulz, A., Ort, O., Beyer, P. and Kleinig, H. (1993) SC-0051, a 2-benzoyl-cyclohexane-1,3dione bleaching herbicide, is a potent inhibitor of the enzyme phydroxyphenylpyruvatedioxygenase. FEBS Lett, 318, 162-166.
Mayer, K.M., McCorkle, S.R. and Shanklin, J. (2005) Linking enzyme sequence to function
using Conserved Property Difference Locator to identify and annotate positions likely to control
specific functionality.BMC Bioinformatics, 6, 284.