Methods S1
Generation of KAI2 S95A mutants
Molecular cloning
The KAI2 coding sequence was modified by site-directed mutagenesis using overlapping PCR. The
5ʹ end of KAI2 was amplified using oligonucleotides MW311 (5ʹ–
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGTGTGGTAGAAGAAGC–3ʹ; Gateway attB1 recombination site underlined, start codon in bold) and MW366 (5ʹ–
TCATGGCAGAAACAGCGTGGCCA–3ʹ; modified base to mutate serine 95 to alanine in red).
The 3ʹ end of KAI2 was amplified using oligonucleotides MW365 (5’– CTTTGTTGGCCACGCTGTTTCTG–3ʹ) and MW312 (5ʹ– GGGGACCACTTTGTACAAGAAAGCTGGGTTTCACATAGCAATGTCATTAC –3ʹ; attB2 recombination site underlined, stop codon in bold). Amplification was performed with 25 cycles using Phusion polymerase (New England
Biolabs) and a cloned KAI2 coding sequence (Waters and Smith, 2013) as template. After amplification, reactions were diluted 100-fold, mixed in a 1:1 ratio and used as a template in a second
round of PCR using oligonucleotides MW311 and MW312. The resultant full length KAI2 (S95A)
coding sequence was purified, cloned into pDONR207 with BP clonase II (Life Technologies), and
verified by sequencing.
The KAI2 promoter sequence, comprising 110 bp of 5ʹ UTR and 776 bp before the start codon of
the adjacent gene (At4g37480), was amplified using oligonucleotides MW363 (5ʹ–
AAGCTTTATGGTTTACTCAGGTGGGAAC–3ʹ; HindIII site underlined) and MW364 (5ʹ–
GGCGCGCCCTCTCTAAAGAAGATTCTTCTC–3ʹ; AscI site underlined). Amplification was performed using Phusion polymerase and genomic DNA from Landsberg erecta as a template. The purified PCR product was cloned into pCR2.1-TOPO (Life Technologies) and verified by sequencing.
The KAI2 promoter sequence was excised by restriction digestion, and cloned into pMDC43 (Curtis
and Grossniklaus, 2003) from which the CaMV 35S promoter and mGFP6 coding sequences were
removed by digestion with HindIII and AscI. This procedure yielded a Gateway-compatible binary
Destination vector (pKAI2pro-GW) into which the KAI2 (S95A) coding sequence was inserted using LR clonase II (Life Technologies), generating pKAI2-KAI2-S95A. In parallel, the wild type
KAI2 coding sequence (Waters and Smith, 2013) was also transferred into the same Destination
vector, generating pKAI2-KAI2. The recombinant plasmids were verified by sequencing, and transferred into Agrobacterium GV3101.
Plant transformation
Homozygous kai2-2 plants were transformed with each construct via the floral dip method (Clough
and Bent, 1998). Primary transgenic seed were selected on sterile half-strength MS medium supplemented with 20 µg/ml hygromycin B, and resistant T1 seedlings were transferred to soil. T2 seed
was screened for segregation of the transgene, and lines exhibiting a 3:1 ratio of resistant-tosensitive seedlings were propagated further to identify homozygous lines in the T3 generation. Experiments were performed on T3 and T4 seed.
Hypocotyl elongation assays
Hypocotyl elongation assays were performed under red light as described previously (Waters et al.,
2012).
Supplementary References
Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J, 16, 735–743.
Curtis, M.D. and Grossniklaus, U. (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol, 133, 462–469.
Waters, M.T. and Smith, S.M. (2013) KAI2- and MAX2-Mediated Responses to Karrikins and
Strigolactones Are Largely Independent of HY5 in Arabidopsis Seedlings. Mol Plant, 6, 63–75.
Waters, M.T., Nelson, D.C., Scaffidi, A., Flematti, G.R., Sun, Y.K., Dixon, K.W. and Smith,
S.M. (2012) Specialisation within the DWARF14 protein family confers distinct responses to
karrikins and strigolactones in Arabidopsis. Development, 139, 1285–1295.