Allan Wilson Centre Summer Studentship 2011-2012
Student: Mick Westbury
Supervised by: Prof. Lisa Matisoo-Smith/ Dr. Ann Horsburgh
Domestic sheep
Modern domestic sheep are believed to have been first tamed and domesticated during
the Pre-pottery Neolithic B period, approximately 9000 years ago. Evidence has shown that a
number of different domestication events have occurred and given rise to the multiple
maternal haplotypes that can be seen in modern domestic sheep (Meadows et al., 2007). The
two major maternal lineages have been coined haplotypes A and B. Other minor lineages
have also been found; haplotypes C, D and E. Studies have shown that haplotype A most
likely originated of the Asiatic mouflan sheep (O.orientalis) eastern populations while
haplotype B most likely originates with Asiatic mouflan sheep populations found in Turkey
and western Iran (Horsburgh and Rhines, 2010).
Descendents from these original domestication events can be found all over the world.
Examples of such include the fat-tailed sheep in South Africa, Romney sheep in New
Zealand and Merino European sheep. These sheep are seen as major sources of income and
food in their respective countries (Almeida, 2011). South Africa is home to a wide range of
sheep breeds (Snyman and Jackson-Moss, 1970), some of which include the fat-tailed breeds
Damara, Namaqua Afrikaner, and Ronderib Afrikaner. These breeds are now gaining more
international recognition as “no-care” breeds and are consequently well suited to live sheep
trades. These breeds are much more robust than many European wool breeds and can tolerate
more extreme environments along with large changes to their environments so are starting to
become more identified as potentially economically valuable breeds (Almeida, 2011). The
Damara and Namaqua Afrikaner indigenous South African sheep breeds arrived alongside
the Khoi people as they migrated south, to Southwest Africa. Whereas it is believed that the
Ronderib Afrikaner are a descendent breed from a sheep breed that migrated with the Khoi
people but are still separate from the Damara and Namaqua Afrikaner breeds (Soma et al.,
2011). These 3 breeds were the topic of this study.
Namaqua Afrikaner is an ancient breed of sheep which are most likely to have been
originally bred by the Nama people in the Northern Cape and Southern Namibia. This breed
is the most endangered of the South Africa region. The ancestors of the modern Damara
sheep breed most likely originated in South-West Africa and Namibia. These ancestors are
thought to have been bred by, but not restricted to the people of the Himba, Sjimba and
Herero (Almeida, 2011). The Damara are a valuable sheep breed in South Africa as they
undertook a migration through Africa, taking hundreds of years. This migration was
undertaken without any veterinary interventions meaning not only human artificial selection
acted upon the species but so did natural selection. Natural selection acted for disease
resistances and abilities to cope with different environmental conditions. Damara are now
considered an ideal sheep breed for harsh South African farming conditions because of this
and is most likely why they are the most common of the indigenous sheep breeds in South
Africa (Du Toit, 2008). Finally, Ronderib Afrikaner is a sheep breed indigenous to the Cape
region of South Africa. The origin of its name comes from its round ribs. Ronderib is a highly
endangered breed and is mainly found only at specific research stations. This is because its
meat quality and characteristics are less economically valuable than sheep breeds like Dorper
(Almeida, 2011).
The aim of this study was to determine the maternal haplotype types from 3 different
sheep breeds found in South Africa; Damara, Namaqua Afrikaner, and Ronderib Afrikaner by
sequencing their complete mitochondrial genomes. The knowledge of these haplotypes will
help to determine where the breeds may have originated.
Methods
57 sheep tissues samples, in the form of ear clippings were taken from 32 Damara, 15
Namaqua Afrikaner and 10 Ronderib Afrikaner sheep. The Damara and Namaqua ear
clippings were obtained from a farm owned by Dawie du Toit in Prieska in the Northern
Cape of South Africa and the Ronderib samples were obtained from another farm in the
Northern Cape of South Africa.
DNA was extracted using Qiagen’s DNeasy animal tissue DNA extraction kit and
manufacturer’s protocol. The extracted mitochondrial DNA was initially amplified as two
separate fragments. The 8911bp LR1 fragment of the mtDNA genome was amplified using
primers OvisLR1_F and OvisLR1_R, while the 8008bp LR2 fragment was amplified using
primers OvisLR2_F and OvisLR2_R. PCR amplification reactions used 27μl of PCR reagents
and 3μl of extracted DNA. Each PCR reagents mixture contained 6μl of long range buffer,
1.2μl of dNTPs (0.4mM of each nucleotide), 0.6μl forward (F) primer (0.4μM), 0.6μl reverse
(R) primer (0.4μM), 0.9μl DMSO (3mM), 0.5μl LR enzyme (0.083U/μM) and 17.2μl ddH2O.
PCR conditions consisted of an initial denaturation period at 92°C for 2 minutes, 10 cycles
of; denaturation at 92°C for 10 sec, annealing at 55°C for 10 seconds, extension at 68°C for 8
minutes 30 seconds, 20 cycles of; denaturation at 92°C for 10 sec, annealing at 55°C for 15
sec, extension at 68°C for 8 minutes 30 seconds with 20 seconds being added to each step
after each cycle, and a final extension step at 68°C for 7 minutes. After the PCR
amplification reaction, samples underwent gel electrophoresis and were run on SYBR safe
stained 2% agarose gels in TAE buffer to see if the target DNA fragments had amplified
correctly. Successfully amplified PCR products were purified using QIAGEN MinElute PCR
purification kit and protocol. The DNA concentration of the purified PCR products in ng/μl
was obtained by using a nanodrop spectrometer. Purified PCR products then underwent a
fragmentase reaction to cut the long range PCR products into smaller fragments for
sequencing. 1μg of total DNA from each sample was used which contained equal quantities
of each amplified fragment. 2μl of fragmentase reaction buffer, 0.2μl of BSA was added to
the DNA then ddH2O was added to make 18μl total volume. The reagents were incubated at
room temperature for 5 minutes before 2μl of fragmentase enzyme was added. The reaction
then underwent an initial incubation at 4°C for 1 minute before being incubated at 37°C for
18 minutes. After that, 5μl of 0.5M EDTA was added to stop the fragmentase reaction.
Products from this reaction underwent a cleanup process by using a QIAGEN MinElute
reaction cleanup kit and the manufacturer’s protocol.
Breaking the complete mitochondrial genome into 2 fragments had a low success rate
for many of the samples so each of the two fragments LR1 and LR2 were broken up and
amplified as 2 fragments. LR1 was amplified in 2 fragments, a 5364bp fragment using
primers OvisLR1_F and OvisLR3_R and a 4083bp fragment using primers OvisLR3_F and
OvisLR1_R. LR2 was also amplified as 2 fragments, a 4132bp fragment using primers
OvisLR2_F and OvisLR4_R and a 4472bp fragment using primers OvisLR4_F and
OvisLR1_R. These shorter fragments then followed the same protocol as the longer ones and
had higher success rates for amplification.
Primer name
Primer sequence 5’- 3’
OvisLR1_f
ACCACACCCCCACGGGAGAC
OvisLR1_r
ACACGCCTAGTGCGATGGTAATGA
OvisLR2_f
CCTTGCCCCCACACCCGAAC
OvisLR2_r
GCGGTGGCTGGCACGAGATT
OvisLR3_f
TGGGCTCCACCCCCACGAAA
OvisLR3_r
GGGTTGGCCTAGTTCGGCG
OvisLR4_f
AGGGCCCAACACCCGTCTCA
OvisLR4_r
TGGCTGTGAAGGAGGTGGCG
Table 1: Primer name and sequences
Results
Due to time constraints, the need to order new LR enzyme and ordering new primers
after the low success rates of the original ones, this project could not be completed so no
results were obtained during the given 10 week period. However, this project will still be
finished in collaboration with Dr. Ann Horsburgh. The samples will be fragmented, tagged
and sequenced using a 454 sequencer.
Side projects
As a side project while Primer orders were arriving, Nguni cattle mtDNA was
extracted and amplified. This was done using the same protocol as mentioned above for the
sheep. The complete mitochondrial genome was amplified as two fragments. One fragment
used primers BOS534 and BOS511 to amplify while the other used primers BOS535 and
BOS510.
References:
Almeida, A. (2011). The Damara in the context of Southern Africa fat-tailed sheep breeds. Tropical
Animal Health and Production 43, 1427-1441.
Du Toit, D., J. (2008). The indigenous livestock of South Africa.
Horsburgh, K., Ann. and Rhines, A. (2010). Genetic characterization of an archaeological sheep
assemblage from South Africa’s Western Cape. Journal of Archaeological Science 37, 2906-2910.
Meadows, J. R. S., Cemal, I., Karaca, O., Gootwine, E. and Kijas, J. W. (2007). Five Ovine
Mitochondrial Lineages Identified From Sheep Breeds of the Near East. Genetics 175, 1371-1379.
Snyman, M. A. and Jackson-Moss, C. A. (1970). A comparison of leather properties of skins from ten
different South African sheep breeds, (ed.: South African Journal of Animal Science Association of
Crop Science, Uganda.
Soma, P., Kotze, A., Grobler, J. P. and van Wyk, J. B. (2011). South African sheep breeds: Population
genetic structure and conservation implications. Small Ruminant Research.