Supplementary Information
Biotechnological Production of Plant-Specific Hydroxylated Phenylpropanoids
Yuheng Lin1 and Yajun Yan2,*
Supplementary materials and methods
Strains, plasmids and media. E. coli strain XL1-Blue was used for plasmid construction and
propagation. E. coli strain BW25113 containing F’ from XL1-Blue was used for protein
over-expression and whole-cell biocatalysis. Plasmid pZE12-luc was used for gene
over-expression in E. coli (Lin and Yan 2012). Luria-Bertani (LB) medium was used for
growing E. coli cells during gene cloning, plasmid propagation, and inoculum preparation;
while the whole-cell biocatalysis was performed in modified M9 medium (M9Y) containing
(per liter): glycerol (20 g), glucose (2.5 g), yeast extract (5 g), NH4Cl (1 g), Na2HPO4 (6 g),
KH2PO4 (3 g), NaCl (0.5 g), MgSO4·7H2O (1 mmol), and CaCl2·2H2O (0.1 mmol). For the
strains carrying pZE12-luc derived plasmids, ampicillin was supplemented into the medium
to a final concentration of 100 µg/ml.
Construction of plasmids. The plasmid pZE-HpaBC carrying E. coli genes hpaB and hpaC
was constructed in our previous work (Lin and Yan 2012). pZE-His7HpaB and
pZE-His7HpaC were constructed for the over-expression and purification of HpaB and HpaC,
respectively. A 7-histidine tag was fused to the N-terminus of HpaB and HpaC when the
genes were amplified from E. coli genomic DNA using the primers HisHpaB-F/HisHpaB-R
and HisHpaC-F/HisHpaC-R, respectively. The amplified fragments and pZE12-luc were
digested with KpnI and SphI, and then ligated by the NEB quick ligase kit. The primer
1
sequences are listed below (the His-tag sequences are underlined).
HisHpaB-F: gggaaaggtaccatgcatcaccatcatcaccaccataaaccagaagatttccgcgc
HisHpaB-R: gggaaagcatgcttatttcagcagcttatccagcatgttg
HisHpaC-F: gggaaaggtaccatgcatcaccatcatcaccaccatcaattagatgaacaacgcctgc
HisHpaC-R: gggaaagcatgcttaaatcgcagcttccatttccagc
HpaBC substrates screening. The E. coli strain harboring pZE-HpaBC was pre-inoculated
into LB liquid medium containing ampicillin (100 μg/ml) and grown overnight at 37oC. Then
200 µl of the inoculum was transferred into 20 ml of fresh M9Y medium. The E. coli cells
were grown at 37 oC till the OD600 values reached around 0.6 and then transferred to 30oC
and induced by 0.5 mM IPTG. After 3 hours’ protein expression, the substrates umbelliferone,
resveratrol and naringenin were separately added into the cultures to a final concentration of
200 mg/L. After 12 hours’ incubation, the cell free cultures were analyzed by HPLC.
NMR analysis. The produced compounds were extracted from the cultures by the same
volume of acetyl acetate. Then the extracts were dried by a vacuum evaporator and
re-dissolved by DMSO. Further purification was performed by collecting the product peaks
using HPLC. The pure samples were obtained by acetyl acetate extraction and drying again.
The NMR was run using 500-MHz Varian Unity Inova with a 5 mm Broad Band Detection
Probe at 25 oC. For peak 1, 1H NMR data (500 MHz, DMSO-d6, Fig.S3) δ: 10.20 (br s, 1H,
OH-7), 9.38 (br s, 1H, OH-6), 7.86 (d, 1H, 4-H), 6.97 (s, 1H, 5-H), 6.73 (s, 1H, 8-H), 6.16 (d,
1H, 3-H) and
13
C NMR data (125 MHz, DMSO-d6, Fig.S4) δ: 160.76 (C-2), 150.35 (C-7),
148.46 (C-9), 144.42 (C-4), 142.85 (C-6), 112.30 (C-5), 111.49 (C-3), 110.74 (C-10), 102.62
(C-8) are consistent with the 1H and
13
C NMR data of esculetin from SDBS (Spectral
Database for Organic Compounds, SDBS No.: 23227) and previous report (Li et al. 2004).
2
For peak 2, 1H NMR data (500 MHz, acetone-d6, Fig.S5) δ: 6.26 (t, 1H, 4’-H), 6.52 (d, 2H,
2’,6’-H), 6.80 (d, 1H, olefinic H), 6.83 (d, 1H, 5-H), 6.91 (dd, 1H, 6-H), 6.95 (d, 1H, olefinic
H), 7.07 (d, 1H, 2-H), 8.17 (br s, 2H, 3’-OH and 5’-OH)，8.02 (br s, 1H, OH) and 7.89 (br s,
1H, OH) and
13
C NMR data (125 MHz, acetone-d6, Fig.S6) δ: 102.77 (C4’), 105.68 and
105.77 (C-2' and 6'), 113.95 (C-2), 116.35 (C-5), 120.08 (C-6), 127.02 (olefinic), 129.48
(olefinic), 130.82 (C-1), 140.94 (C-1'), 146.22 (C-4), 146.26 (C-3), 159.60 and 159.70 (C-3'
and 5') are consistent with the previously reported 1H and 13C NMR data of piceatannol (Han
et al. 2008). For Peak 3, 1H NMR data (500 MHz, acetone-d6, Fig.S7) δ: 5.40 (dd, 1H, 2-H),
3.14 (dd, 1H, 3a-H), 2.73 (dd, 1H, 3b-H), 5.95 and 5.96 (s, 6-H and 8-H), 7.03 (s, 1H, 2’-H),
6.87 (d, 2H, 5’-H and 6’-H), 12.17 (br s, 1H, 5-OH), , 9.56, 8.02 and 8.08 (3 other OHs) are
consistent with the previously reported eriodictyol NMR data (Encarnacion et al. 1999). Ring
numbering of the compounds is shown in Figure S8.
Protein purification and in vitro enzyme assay. The E. coli strain was transformed with
pZE-His7HpaB and pZE-His7HpaC separately. The fresh transformants were pre-inoculated
in LB medium containing 100 µg/ml ampicillin and grown at 37°C aerobically overnight. In
the following day, the pre-inoculums were transferred into 50 ml of fresh LB medium at a
ratio of 1:100. The cultures were cultivated at 37 °C till the OD600 values reached about 0.6
and then induced by 0.5 mM IPTG. After additional 6 hours for protein expression at 30oC,
the cells were harvested and the proteins were purified using His-Spin Protein MiniprepTM kit
(ZYMO RESEARCH) according to the manual. The BCA kit (Pierce Chemicals) was used to
estimate protein concentrations. The stock concentrations of purified HisHpaB and HisHpaC
were 73.8 and 68.3 µM, respectively. The HpaBC enzyme assays were carried out according
to the protocol described by Louie et al. with minor modifications (Louie et al. 2003). The 1
ml reaction system contains KPi Buffer (20 mM, pH = 7.0), FAD (10 μM), NADH (1 mM),
3
HpaB (0.5 μM), HpaC (0.5 μM), substrates (from 10 to 1000 μM). The reactions were
conducted at 30°C for 1 min (for 4HPA), 10 min (for resveratrol), and 15 min (for
umbelliferone) and terminated by acidification with 50 µl of HCl (20%). The reaction rates
were calculated according to the product formation and substrate consumption, which were
measured by HPLC. Apparent kinetic parameters were determined by non-linear regression
of the Michaelis-Menten equation using OriginPro8TM.
Whole-cell biocatalysis. The E. coli strain harboring pZE-HpaBC was first cultivated in 50
ml LB liquid medium at 37oC till OD600 values reached 0.6. Then the cells were transferred to
30°C and induced with 0.5 mM IPTG for additional 6 hours. After that, cells were harvested,
re-suspended in 15 ml M9Y medium (OD600 = 9.6), and incubated in a rotary shaker at 300
rpm. Umbelliferone and resveratrol were separately supplemented into the cultures to a final
concentration of 1.5 g/L. Meanwhile, 1.5 mM of ascorbic acid was added to avoid the
spontaneous oxidation of substrates and products. When the substrate concentrations fell
below 0.5 g/L, additional 1 g/L substrates were supplemented. Umbelliferone was added
twice at 2.5 and 5.5 h, while resveratrol was added only once at 8 h. Samples were taken
every few hours and analyzed by HPLC.
HPLC analysis. Quantitative analysis of umbelliferone, resveratrol, naringenin, esculetin,
piceatannol, and eriodictyol was performed by HPLC (Dionex Ultimate 3000) equipped with
a reverse-phase ZORBAX SB-C18 column and an Ultimate 3000 Photodiode Array Detector.
Solvent A is water containing 0.05% trifluoroacetic acid (TFA); solvent B is acetonitrile
containing 0.05% TFA. The following gradient was used at a flow rate of 1 ml/min: 10 to 70 %
of B for 15 min, 70 to 10% B for 1 min, and 10% B for additional 4 min.
4
Figure S1
Fig. S1 Comparison of the retention times and UV adsorption profiles of the produced compounds
with those of the corresponding commercial standards.
5
Figure S2
Fig. S2 Kinetic parameters of HpaBC towards umbelliferone (A), resveratrol (B) and 4HPA (C). The
Km and Vmax values were determined using OriginPro8TM through non-linear regression of the
Michaelis-Menten equation. R2 values of the equations fitting for (A), (B) and (C) are 0.989, 0.991
and 0.996, respectively. Kcat values were calculated according to the formula Kcat= Vmax/[E]. Each data
point is an average value of two independent experiments.
6
Figure S3
Fig. S3 1H NMR spectrum of the hydroxylated umbelliferone (predicted as esculetin)
7
Figure S4
Fig. S4 13C NMR spectrum of the hydroxylated umbelliferone (predicted as esculetin)
8
Figure S5
Fig. S5 1H NMR spectrum of the hydroxylated resveratrol (predicted as piceatannol)
9
Figure S6
Fig. S6 13C NMR spectrum of the hydroxylated resveratrol (predicted as piceatannol)
10
Figure S7
Fig. S7 1H NMR spectrum of the hydroxylated naringenin (predicted as eriodictyol). The arrow
indicates a peak from unknown impurities.
11
Figure S8
Fig. S8 Ring numbering of esculetin, piceatannol, and eriodictyol.
12
Supplementary References
Encarnacion DR, Nogueiras CL, Salinas VHA, Anthoni U, Nielsen PH, Christophersen C.
1999. Isolation of eriodictyol identical with huazhongilexone from Solanum
hindsianum. Acta Chem Scand 53(5):375-377.
Han SY, Bang HB, Lee HS, Hwang JW, Choi DH, Yang DM, Jun JG. 2008. A New Synthesis
of Stilbene Natural Product Piceatannol. Bulletin of the Korean Chemical Society
29(9):1800-1802.
Li L, Xu LW, Jiang YF, Xi CJ, Wang HQ, Suo YR. 2004. Isolation, characterization and
crystal structure of natural eremophilenolide from Ligularia sagitta. Zeitschrift Fur
Naturforschung Section B-a Journal of Chemical Sciences 59(8):921-924.
Lin Y, Yan Y. 2012. Biosynthesis of caffeic acid in Escherichia coli using its endogenous
hydroxylase complex. Microb Cell Fact 11(1):42.
Louie TM, Xie XS, Xun L. 2003. Coordinated production and utilization of FADH2 by
NAD(P)H-flavin oxidoreductase and 4-hydroxyphenylacetate 3-monooxygenase.
Biochemistry (Mosc) 42(24):7509-17.
13