Citation
Jérémy Lothier, André Van Laere, Marie-Pascale Prud’homme,
Wim Van den Ende, Annette Morvan-Bertrand.
Cloning and characterization of a novel fructan 6-exohydrolase
strongly inhibited by sucrose in Lolium perenne
Planta 240(3): 629-643.
Archived version
Author manuscript: the content of this pre-print version is
identical to the content of the published paper, but without the
final typesetting by the publisher
Published version
insert
link
to
the
published
version
of
your
paper
http://link.springer.com/article/10.1007%2Fs00425-014-2110-6
Journal homepage
insert
link
to
the
journal
homepage
http://link.springer.com/journal/425 .
Author contact
your email wim.vandenende@bio.kuleuven.be
your phone number + 32 (0)16321952
Klik hier als u tekst wilt invoeren.
IR
(article begins on next page)
Abstract
of
your
paper
Abstract
Lolium perenne is a major forage grass species that accumulates fructans, mainly
composed of β(2,6) linked fructose units. Fructans are mobilized through strongly increased
activities of fructan exohydrolases (FEHs), sustaining regrowth following defoliation. To
understand the complex regulation of fructan breakdown in defoliated grassland species, the
objective was to clone and characterize new FEH genes in L. perenne. To find FEH genes
related to refoliation, a defoliated tiller base cDNA library was screened. Characterization of the
recombinant protein was performed in Pichia pastoris. In this report, the cloning and enzymatic
characterization of the first 6-FEH from L. perenne is described. Following defoliation, during
fructan breakdown, Lp6-FEHa transcript level unexpectedly decreased in elongating leaf bases
(ELB) and in mature leaf sheaths (tiller base) in parallel to increased total FEH activities. In
comparison, transcript levels of genes coding for fructosyltransferases (FTs) involved in fructan
biosynthesis also decreased after defoliation but much faster than FEH transcript levels. Since
Lp6-FEHa was strongly inhibited by sucrose, mechanisms modulating FEH activities are
discussed. It is proposed that differences in the regulation of FEH activity amongst forage
grasses influence their tolerance to defoliation.
Keywords: Defoliation, Fructan, Fructan exohydrolase, Fructosyltransferase, Lolium,
Pichia.
Abbreviations:
6G-FFT 6G-Fructan:fructan fructoyltransferase
6-SFT 6-Sucrose:fructan fructosyltransferase
DP Degree of polymerisation
ELB Elongating leaf bases
ES External sheath
FEH Fructan exohydrolase
FT Fructosyltransferase
IS Internal sheath
MS Middle sheath
SST Sucrose:sucrose fructosyltransferase
WSC Water soluble carbohydrates
Introduction
Fructans, water soluble fructose based oligo- and polysaccharides, are the major reserve
carbohydrates in 15% of flowering plant species (Hendry 1993). The size and the glycosidic
linkages of fructans vary markedly between and within fructan accumulating plant species.
Dicotyledonous plants are considered to contain mainly β(2,1) glycosidic linkages whilst
monocotyledonous species accumulate both β(2,1) and β(2,6) linked fructans with a higher
proportion of β(2,6) linkages (Chatterton et al. 1990; Cairns and Ashton 1993). Alongside their
obvious function as reserve compounds in plants, fructans are believed to increase the tolerance
to cold and drought stresses (Pilon-Smits et al. 1999; Kawakami et al. 2008), most probably by
stabilizing plant membranes (Hincha et al. 2002; Livingston et al. 2009). Furthermore, there is
increasing evidence that fructans may participate in reactive oxygen species (ROS) scavenging
in the vicinity of the tonoplast, making them part of the cellular antioxidant mechanisms
(Peshev et al. 2013). Fructans might also act as immunomodulators (Vogt et al. 2013; Peshev
and Van den Ende 2014) and as stress signals (Van den Ende 2013) contributing to their
multifunctionality (Van den Ende and El Esawe 2014). During vegetative stage in grasses and
cereals, fructans are mainly stored in leaf sheaths and elongating leaf bases (ELB) of tiller bases
(Volenec 1986).
Fructans are biosynthesized from sucrose by four fructosyltransferase (FT) activities.
Sucrose:sucrose 1-fructosyltransferase (1-SST, EC 2.4.1.99) initiates the fructan synthesis and,
together with fructan:fructan 1-fructosyltransferase (1-FFT, EC 2.4.1.100), produces β(2,1)
linked fructans (Van Laere and Van den Ende 2002). Sucrose:fructan 6-fructosyltransferase (6SFT) produces β(2,6) linked fructans (Sprenger et al. 1995; Lasseur et al. 2011) and
fructan:fructan 6G-fructosyltransferase (6G-FFT) initiates the synthesis of fructans with an
internal glucosyl residue (Shiomi 1981; Lasseur et al. 2006). Fructan mobilization occurs when
energy and carbon skeletons are needed. In grasses, fructans are degraded following defoliation
until restoration of adequate photosynthetic capacity (Volenec 1986; Prud'homme et al. 1992;
Morvan-Bertrand et al. 2001). During the first days following defoliation, the regrowth is
positively related to the amounts of fructans present in tiller bases before defoliation (MorvanBertrand et al. 1999). Fructans can be used during leaf senescence in summer dormant pasture
grasses (Ballard et al. 1990). During reproductive stage, fructans are found in stems, and their
mobilization by FEHs may sustain grain filling, especially under terminal drought (Schnyder
1993; Zhang et al. 2009; Joudi et al. 2011).
Fructan breakdown is catalyzed by fructan exohydrolases (FEHs), differing by the linkage(s)
and the fructan(s) on which they act. Fructan 1-exohydrolases (1-FEHs) (EC 3.2.1.153) and
fructan 6-exohydrolases (6-FEHs) (EC 3.2.1.154) preferentially degrade β(2,1) and β(2,6)
linked fructans, respectively. FEHs have probably evolved from cell wall invertases by few
mutational changes (Le Roy et al. 2007). Both enzyme types belong to family 32 of glycoside
hydrolases (GH32), also harbouring FTs and vacuolar invertases. In Poaceae, 1-FEHs have
been purified to homogeneity from barley (Henson and Livingston 1998) and wheat (Van den
Ende et al. 2003a; Van Riet et al. 2008) and cDNAs of 1-FEH isoforms have been cloned from
wheat (Van den Ende et al. 2003a, Van Riet et al. 2008), perennial ryegrass (Lothier et al. 2007)
and from Bromus pictus (Del Viso et al. 2009). 6-FEHs have been purified to homogeneity
from oat (Henson and Livingston 1996), perennial ryegrass (Marx et al. 1997) and wheat (Van
den Ende et al. 2005; Van Riet et al. 2006) and cDNAs of 6-FEHs have been cloned from wheat
(Van den Ende et al. 2005; Van Riet et al. 2006) and timothy (Tamura et al. 2011). Two other
types of FEH have been identified in wheat, 6&1-FEHs degrading both β(2,1) and β(2,6)
linkages (Kawakami et al. 2005) and
6-KEHs that specifically hydrolyse 6-kestotriose.
Surprisingly, 6-FEHs and 6&1-FEHs have also been purified and cloned from non-fructan
plants such as Arabidopsis (De Coninck et al. 2005) and sugar beet (Van den Ende et al.
2003b). Their roles in non-fructan accumulators are still puzzling. It was proposed to term these
proteins “defective invertases” rather than FEHs (Le Roy et al. 2007; Van den Ende et al.
2009). Recently, Nin88, an apoplastic defective invertase from tobacco lacking FEH side
activities, was proposed to act as an indirect activator of active cell wall invertases (Le Roy et
al. 2013). Therefore, “defective invertases”, with or without intrinsic 6-FEH activities, might
play a role in cell wall invertase regulation.
In grasses and cereals, fructan pool size is the result of the balance between biosynthesis and
degradation (Wagner and Wiemken 1986, 1989). Following defoliation, a decrease of FT
activities and an increase of total FEH activity against native fructans were observed in
perennial rygrass (Lolium perenne) together with fructan mobilization in tiller bases (Marx et al.
1997; Morvan-Bertrand et al. 2001). Since perennial ryegrass contains a high proportion of
β(2,6) linked fructans but also β(2,1) linked fructans (Pavis et al. 2001), both 6-FEH and 1-FEH
activities are supposed to increase in the tissues left behind after defoliation. Indeed, Marx et al.
(1997) observed an increase of both 1-FEH activity (1,1-kestotetraose as substrate) and 6-FEH
activity (6,6-kestotetraose as substrate) in stubble and roots of L. perenne after 26 h of
regrowth. By contrast, a decrease of 1-FEH activity after defoliation was found with inulin as
substrate (Lothier et al. 2007). Together, these results indicate that 1-FEH activities related to
low or high degree of polymerization (DP) fructans are probably due to different 1-FEH
isoforms, and that the 1-FEH activity against lower DP fructans may be of greater importance in
L. perenne after defoliation. However, knowing that β(2,6) linkages are predominant in L.
perenne fructans, 6-FEHs are expected to be the most dominant enzymes involved in fructan
mobilization after defoliation in this species.
Although fructan breakdown is crucial for grass perennity, especially in the context of climate
changes (Livingston et al. 2009), the mechanisms of FEH induction are still largely unexplored.
Since many FEHs are inhibited by sucrose at the level of enzyme activity, Marx et al. (1997)
suggested that the decrease of sucrose level after defoliation could lead to the increase of FEH
activity in ryegrass by alleviating the sucrose inhibition of FEHs. However, the increase of FEH
activities measured in vitro can not be due to the disinhibition of FEH proteins following
sucrose depletion after defoliation as might be the case in planta, since in vitro FEH activity is
measured in protein extracts that are free of sucrose (Morvan-Bertrand et al. 2001). This
suggests that additional regulatory mechanisms may play a role. The increase of FEH activities
in vitro may result from other post-transcriptional regulatory mechanisms and/or from
transcriptional regulation. 6-FEH activity increased after defoliation as a result of de novo
protein synthesis in ochardgrass (Yamamoto and Mino 1989) and as a result of increased
transcript levels in timothy (Tamura et al. 2011). In chicory roots, the transcript level of one of
the two 1-FEH isoforms increased after defoliation while the transcript level of the other one
remained at a constant low level (Van den Ende et al. 2001). The transcript levels of both
isoforms in chicory are induced by cold (Michiels et al., 2004). It was shown before in
perennial ryegrass that the transcript level of a 1-FEH isoform (Lp1-FEHa) decreased after
defoliation together with a decrease of 1-FEH activity against inulin (Lothier et al. 2007). All
together, these data suggest that, following defoliation, FEH expression may be controlled at
transcriptional and post-transcriptional levels and that different FEH isoforms may be
differentially regulated.
Despite the fact that 6-FEHs are obvious key enzymes associated with perennity of forage
species, cDNAs coding for 6-FEHs from grassland species subjected to defoliation have only
been cloned from timothy (Tamura et al. 2011). Thus, as a contribution to understand the
complex regulation of fructan breakdown in defoliated grassland species, the first cDNA coding
a 6-FEH (termed Lp6-FEHa) was cloned from perennial ryegrass (L. perenne), a major forage
grass of temperate areas. The activity of the recombinant enzyme was confirmed by
heterologous expression in Pichia pastoris and a transcriptional analysis was performed
following defoliation. For comparison, the transcript levels of Lp1-FEHa and the three available
L. perenne FT genes (Lp1-SST, Lp6G-FFT, Lp6-SFT) were also investigated, in parallel with
total FEH and 1-SST activities.
Materials and methods
Plant material
Seeds of Lolium perenne L. var Bravo obtained from INRA (UE0326 domaine experimental du
Pin, Le Pin-au-Hars, France) were germinated in 9 L pots and grown hydroponically during
eight weeks on a nutrient solution as previously described by Prud'homme et al. (1992). The
nutrient solution was aerated continously and replaced every week. Plants were grown in a
greenhouse with day/night temperatures of 22 / 18°C and a photoperiod of 16 h of natural light
supplemented by a photosynthetic photon flux density of 110 mol photons m-2s-1 (Phyto tubes,
GTE Claude Eclairage, Puteaux, France).
The experiment was initiated when plants were 8 weeks old. All plants were defoliated at 9:00
AM (3h after light on) at 4.5 cm above ground. Plants were harvested 0, 12 and 24 h after the
defoliation and dissected in elongating leaf bases (ELB), mature leaf sheaths decomposed in
inner sheaths (IS), medium sheaths (MS) and external sheaths (ES) (Fig. 1). Sampling was done
in triplicate. Harvested tissues were frozen in liquid nitrogen and stored at -80°C until further
analysis of water soluble carbohydrates (WSC), enzyme activities and RNA transcripts.
Preparation and screening of a L. perenne cDNA library
Eight week old plants were defoliated. After 12 h, stubble (containing leaf sheaths and
ELB; 1.5 g FW) was ground in liquid nitrogen. Powder obtained was used to purify poly
(A+) RNA with Dynabeads oligo (dT)25 kit (Life technologies, ThermoFischer Scientific,
Waltham, MA, USA) by following the manufacturer’s recommendation. Double
stranded cDNA was synthesized from poly (A+) RNA and a cDNA library was
constructed using a Lambda-Zap cDNA library kit and the Gigapack III Gold Cloning Kit
(Agilent technologies, Santa Clara, CA, USA). The cDNA library was screened with a
989 bp L. perenne PCR product. This PCR product was previously obtained with sense
primer WES (5’-TGGGAGTGCCCGGACTTC-3’) based on the conserved amino acid
sequence WECPD and antisense primer FEHAS (5’-ATGGTCCATGCGCTGAGCT-3’)
designed from the conserved nucleotidic sequences from wheat 1-FEH w2 (accession
no. AJ508387) and barley 1-feh (accession no. AJ605333). The probe was labeled
with [-32P] dCTP by using random priming method with the NEBlot kit (New England
BioLabs Inc., Ipswich, MA, USA). Membranes were hybridized overnight at 42°C and
washed twice in 2 SSC, SDS 0.5% (w/v), for 15 min at room temperature, then rinsed
two times in the same buffer at 56°C. After three rounds of purification, positive clones
were excised and recircularised in a pBluescript vector (Agilent technologies).
Sequencing of positive clones was performed by Genome Express (Meylan, France). A
partial cDNA Lp6-FEHa was obtained.
cDNA 5’ cloning
In order to clone the missing 5’ part of the cDNA, RNA was isolated from stubble of 8
week old plants using the RNeasy plant mini kit (Qiagen, Valencia, CA, USA) coupled
to a DNase treatment (Qiagen). RNA was quantified using a RNA BioPhotometer
(Eppendorf) and visualized after electrophoresis on agarose gels 1.5% (w/v). A 1 µg
aliquot was used to generate cDNA with an i-script cDNA synthesis kit (Bio-Rad,
Hercules, CA, USA). Four PCR reactions were performed on cDNA using sense
primers
FEHA
(5’-ATGGCCCAAGCTTGGGCCTT-3’),
ATGGCCCAAGCCTGGGCCTT-3’),
FEHC
FEHB
(5’-
(5’-ATGGCNCAAGCNTGGGCCTT-3’),
FEHD (5’-ATGGCNCAAGCNTGGGCNTT-3’) based on the conserved amino acid
sequences MAQAWAF found in wheat and barley 1-FEH (accession no. AJ508387
and AJ605333) and antisense primer FEH6-1 (5’- GTGCTGAATGAGAGTACGCT -3’)
based on the 3’ UTR of the Lp6-FEHa partial cDNA sequence. One clear band
appeared at this stage with FEHD and FEH6-1 primers. The corresponding PCR
product was sequenced and the overlap region was found to match exactly with Lp6FEHa partial cDNA sequence. Multiple sequence alignments and phylogenetic trees
were constructed by the neighbor-joining method, using the CLUSTALW and Drawtree
programs of Phylogeny (http://phylogeny.fr).
Expression in Pichia pastoris
To construct the expression plasmid PICLp6FEH, containing the mature protein part, PCR was
done with PICFEHs (5’-GATCCGGCCCAGCCGGCCGGAAGTCCCCTCCATTGCC-3’)
and PICFEHas (5’-GATCCCCGCGGTCAACCCTTATTCACATTCAC-3’) primers with
adaptors. SfiI and SacII restriction sites are indicated in bold in the primers. PCR was performed
with proofreading Pfu DNA polymerase (Promega, Madison, WI, USA). The PCR protocol was
as follows: 95°C for 5 min followed by 30 cycles of 95°C for 20 s, 60°C for 30 s and 72°C for 5
min, and then a single 72°C for 9 min. PCR products and pPICZalpha A (expression vector,
Life technologies) were digested with restriction enzymes corresponding to restriction sites
introduced by PCR and purified with Nucleospin Extract Kit (Macherey-Nagel, Düren,
Germany). The digested vector was dephosphorylated with CIAP (Agilent technologies), and
then PCR products were cloned in frame behind the alpha-factor signal of the pPICZalpha A
vector. The plasmids were transformed into Escherichia coli competent cells as described by
Van den Ende et al. (2001). Cells were plated on 2 x yeast tryptone (YT) medium supplemented
with zeocine as a selection marker. Positive colonies were used for vector amplification. The P.
pastoris wild-type strain X33 was transformed by electroporation with 20 g PmeI-linearized
PICLp6FEH. Transformants were selected on YPDS/zeocine plates (Life technologies). To
produce recombinant Lp6-FEHa enzyme for characterization, a 90 mL pre-culture medium
(BMGY) was inoculated with a single colony and incubated overnight at 30°C, 200 rpm. Cells
were harvested by centrifugation and resuspended in 20 mL of induction medium (BMMY) and
incubated for 4 d at 29°C. Methanol was replenished every day to a final concentration of 2%
(v/v). Protein purification was as described in De Coninck et al. (2005).
Determination of enzyme activities of the P. pastoris expressed recombinant Lp6-FEHa
Sodium azide 0.02% (w/v) was added to all buffers to prevent microbial growth. Proteins were
diluted in 50 mM Na-acetate buffer pH 5.0 and incubated with substrates for different time
intervals at 30°C. L. perenne high-molecular-weight fructans were prepared as described by
Morvan et al. (1997). Briefly, fructans were extracted from stubble of 8-week old plants of L.
perenne grown for 4 d under continuous illumination and nutrient solution at 5°C. Fructans
were extracted first with boiling 80% ethanol (4 mL g-1 FW) for 1 h and then with boiling water
(5 mL g-1 FW) for 1 h. Both extracts were combined and the volume was reduced by rotary
evaporation. The resulting concentrated extract was depigmented by an overnight incubation
with polyvinylpolypyrrolidone followed by centrifugation. Fructans in the supernatant were
then separated from sucrose, glucose and fructose by passage through a gel filtration column
(Sephadex G25; Sigma-Aldrich). The remaining charged material was removed by passage
through cation-exchange and anion-exchange resins (Amberlite IR120 and IRA 416 from
Sigma-Aldrich, in the hydrogen and formate forms, respectively). For origins of other substrates
see De Coninck et al. 2005. Enzyme amounts and/or incubation times were adjusted to result in
the linear production of fructose during the incubation period. To test the inhibitory effect of
sucrose, it was added to the incubation mixture at 10, 20 or 40 mM end concentration, in line
with the assumed sucrose concentration range in the vacuole (20 mM, Winter et al. 1993; 100
mM, Pollock, 1986). Carbohydrates of the assay mixture were separated and quantified by highperformance anion exchange chromatography with pulsed amperometric detection (HPAECPAD DX-300, ThermoFischer scientific, Dionex, CA, USA) on an analytical CarboPac PA100
column (4 x 250 mm) as described in Van den Ende and Van Laere (1996).
Extraction and analysis of water soluble carbohydrates (WSC)
Twenty five mg freeze dried plant tissue ground to a fine powder were placed in 14 mL
polypropylene round-bottom tube (Falcon, Becton Dickinson Labware, Franklin Lakes, NJ,
USA) with 2 mL of 80% ethanol also containing 0.5 g mL -1 mannitol as internal standard. The
tube contents were mixed and incubated for 15 min at 80°C. After ethanol extraction, the
sample was centrifuged at 10,000 g for 10 min. The supernatant was preserved and 2 mL of
water was added to the pellet. The tube contents were mixed and incubated for 15 min at 60°C.
After the first aqueous extraction, the sample was centrifuged at 10,000 g for 10 min. The
supernatant was preserved and the aqueous extraction was repeated once with the pellet. The
three supernatants were pooled, evaporated to dryness under vacuum and the residue was
dissolved in 0.5 mL water. Aliquots of the carbohydrate extract (100 µL) were passed through
minicolumns (Mobicols from MoBITec, Göttingen, Germany) packed, from bottom to top, with
150 µL of Amberlite CG-400 II, formiate-form (Fluka, Buchs, Switzerland), 80 µL of
polyvinylpolypyrrolidone (Sigma-Aldrich), and 250 µL of Dowex 50W X8-400 H+-form
(Sigma-Aldrich) to remove charged compounds (Bachmann et al. 1994). Glucose, fructose,
sucrose, and fructans were separated and quantified by HPLC on a cation exchange column
(Sugar-PAK, 300 X 6.5 mm, Millipore Waters, Milford, MA) eluted at 0.5 mL min-1 and 85°C
with 0.1 mM CaEDTA in water, using a refractometer as a sugar detector.
Measurement of total FEH and sucrose:sucrose 1-fructosyltransferase (1-SST) activities in leaf
protein extracts
Plant tissues (1 g FW stored at -80°C) were ground in liquid nitrogen with mortar and pestle.
After grinding, 1 mL of 50 mM citrate-phosphate buffer (pH 5.5) containing 5 mM
dithiothreitol (DTT) was added to the plant tissue powder. The homogenate was centrifuged at
20,000 g for 10 min. An aliquot of the crude extract was desalted on Sephadex G50, which also
removed sucrose from the extract. The assay mixture consisted of 100 µL of enzyme extract
and 100 µL of substrate. For measurement of total FEH activity, high-molecular-weight fructan
(8 mg mL-1) extracted from perennial ryegrass (Morvan et al. 1997) was used as substrate. For
sucrose:sucrose 1-FT (1-SST) assays, 100 mM sucrose was used as substrate. Triplicate
samples were run together with duplicate enzyme blanks (100 µL of enzyme extract and 100 µL
of buffer). For each batch, a chemical hydrolysis control was run by replacing the enzyme
extract by the substrate (sucrose or fructan). The reaction was stopped by boiling for 5 min. For
total FEH activity determination, fructose released was measured enzymatically as described in
Lothier et al. (2010). Briefly, enzymatic analysis of fructose was conducted by mixing the
incubation solution with imidazole buffer containing ATP and NADP + and by adding
successively hexokinase, glucose-6-phosphate dehydrogenase and phosphoglucose isomerase
(Roche Diagnostics, Meylan, France). After incubation at room temperature, the release of
NADPH was determined by measuring absorbance at 340 nm. Total FEH activity was defined
as the amount of fructose released from high-molecular-weight fructan substrate per second per
g FW. For 1-SST activity, 100 µL mannitol (1 g L-1) was added to the assay mixture as internal
standard. The samples were stored at -20°C until desalting with ion exchange resins as
described above for WSC analysis. The product of the 1-SST (1-kestotriose) was measured by
HPLC under the conditions defined above for WSC analysis. 1-SST activity was defined as the
amount of 1-kestotriose produced from sucrose per second per g FW.
RNA isolation and real-time qPCR analysis
RNA was isolated from leaf tissues using the RNeasy plant mini kit (Qiagen) coupled to
a DNAse treatment (Qiagen). RNA was quantified using a RNA BioPhotometer
(Eppendorf) and visualized after electrophoresis on 1.5% (w/v) agarose gels. One µg
aliquot was used to generate cDNA with an i-script cDNA synthesis kit (Bio-Rad). The
cDNA was diluted 1:100 with water and 4 µL was used as a template for real time
qPCR
analysis.
The
gene-specific
primers
were
Lp6FEHs
(TGCCTACCACTCCCAGTCT) and Lp6FEHas (ATGACAGGCTGATCACCAGG) for
Lp6-FEHa;
Lp1FEHs
(GCGGTCTTGGAGCCAGAGC)
(CAGTCCCAATGGTGCCACCC)
for
Lp1-FEHa;
and
Lp1FEHas
(5’-
Lp1SSTs
GCCAGGTCATCCTGCTCTAC-3’) and Lp1SSTas (5’-CCGGCATGAGCTCGTAGTT3’) for Lp1-SST; Lp6G-FFTs (TCTCAACTCTTCGGACATCGA) and Lp6G-FFTas
(TACATGTCGTCAGCCAAGAAG)
for
Lp6G-FFT;
Lp6SFTs
(CAGCTTCTGCAACGACGA) and Lp6SFTas (CCTTAACCATGACGGTCTCG) for
Lp6-SFT. As a marker for constitutive expression, 18S rRNA was amplified with
rRNA18Ss
(5’-CGGATAACCGTAGTAATTCTAG-3’)
and
rRNA18Sas
(5’-
GTACTCATTCCAATTACCAGAC-3’) primers. Similar results were obtained when
specific primers for eIF-4 and GAPDH were used (data not shown). PCR reactions
were performed in a total volume of 15 µL, 500 nM for each primers and 10 µL of iQ
SYBR Green supermix (Bio-Rad) on the Chromo 4 System (Bio-Rad). The qPCR
protocol included a preliminary step of 5 min at 95°C, followed by 35 cycles of 95°C for
15 s and 60°C for 40 s. All the qPCR results were confirmed by three independent
reactions from RNA of the same bulk of plants. Expression levels produced by qPCR
were expressed as a ratio relative to the control point, ELB at time 0, which was set to
1. The specificity of PCR amplification was examined by monitoring the dissociation
curves after qPCR reactions using the Chromo 4 System (Bio-Rad) and by sequencing
the qPCR product, confirming that the correct amplicons were produced from each pair
of primers.
Results
Molecular characterization of Lp6-FEHa
A L. perenne stubble cDNA library was screened with a 989 bp L. perenne nucleotidic probe
and a partial cDNA termed FEHb was obtained. To obtain the 5’end of the coding sequence, the
screening was followed by PCR with degenerated primers based on the conserved amino acid
sequences MAQAWAF found in wheat and barley 1-FEHs (accession no. AJ508387 and
AJ605333) and specific primers from the Lp6-FEHa 3’UTR. As a result, a 1743 bp full length
clone was obtained and designated Lp6-FEHa (accession no. EU219846) containing a long
open reading frame (ORF) encoding 580 amino acids (Fig. 2). Lp6-FEHa has a predicted pI of
5.5 and the cDNA derived molecular mass for the expected mature enzyme is 60.9 kDa. Lp6FEHa contains 5 potential N-glycosylation sites and presents the catalytic triad conserved
among GH32 members: the β-fructosidase motif (NDPXG), the FRDP region and the
EC(V/P)D region (Fig. 2). A hydrophobic N-terminal signal of 20 amino acids was determined
with Signal3P (http://www.cbs.dtu.dK/services/SignalP; Fig. 2, end of the peptide signal
indicated by an open arrow) and the mature Lp6-FEHa was estimated to begin at the 40rd amino
acid residue (Fig. 2; black arrow), based on the N-terminal sequences of chicory and wheat 1FEH mature proteins (Van den Ende et al. 2001, 2003a).
Homology with other GH32 glycoside hydrolases
The deduced amino acid sequence of Lp6-FEHa was aligned with the related translated cDNAs
of Lp1-FEHa; 6-KEH w1, 6&1-FEH w1 and wheat 6-FEH from wheat. Lp6-FEHa is more
homologous to Lp1-FEHa (84% identity) than to the other monocot 6-FEHs such as 6-KEH w1,
6&1-FEH w1, wheat 6-FEH (74, 73 and 48% identity, respectively) and timothy Pp6-FEH
(48%). Identity to 6-FEHs from eudicot species is lower: 44% to sugar beet 6-FEH and 45% to
Arabidopsis 6-FEH. A phylogenetic tree of some GH32 plant FTs and hydrolases is presented
in Fig. 3. Typically, Lp6-FEHa groups together with cell wall invertases (group I) and not with
vacuolar invertases, which group with FTs (group III). Within plant GH32 hydrolases, clearly
two distinct groups can be distinguished. Groups I and II harbour monocot and eudicot
hydrolases, respectively. As expected, Lp6-FEHa belongs to group I.
Functional characterization of the recombinant Lp6-FEH protein
The recombinant Lp6-FEHa was successfully expressed in Pichia pastoris for functional
characterization. No product other than fructose could be detected after incubation of the
recombinant Lp6-FEHa with bacterial levan (data not shown). Of all fructans tested, the
recombinant enzyme preferentially hydrolyzed substrates with predominant β(2,6) linkages.
Amongst β(2,6) fructans tested, 6-kestotriose was the best substrate while bacterial levan and
6G-kestotriose were more slowly hydrolyzed. Amongst β(2,1) fructans, inulin hydrolysis was
neglectible while 1-kestotriose and 1,1-kestotetraose were also hydrolyzed but at a much lower
rate than 6-kestotriose (Table 1). High DP fructans from Lolium perenne, composed by both
β(2,1) and β(2,6) linked fructans with a predominance of β(2,6) linkages, were also degraded by
the recombinant protein (Fig. 4) at a rate close to that of 6G-kestotriose and bacterial levan
(Table 1). Only very low or zero hydrolase activities could be detected towards sucrose during
short incubations (Table 1). However, the small release of glucose from sucrose after 24 h
indicates the presence of low invertase side activity after longer incubation (Fig. 4). The
recombinant Lp6-FEHa was inhibited at 70% and 90% in the presence of 10 mM and 40 mM
sucrose, respectively (Table 2).
Soluble sugar contents, enzyme activities and fructan metabolism gene transcript levels in
defoliated ryegrass
Fructan, sucrose, glucose and fructose levels together with total FEH and 1-SST activities were
followed in elongating leaf bases (ELB) and mature leaf sheaths. Leaf sheaths were separated in
inner sheaths (IS), medium sheaths (MS) and external sheaths (ES) in agreement with their
development IS being the youngest and ES being the oldest (Fig. 1). The relative amounts of
transcripts coding for Lp6-FEHa, Lp1-FEHa, Lp1-SST, Lp6G-FFT and Lp6-SFT genes were
followed in the same tissues. Analyses were performed just before defoliation and 12 and 24 h
after defoliation. Before defoliation, fructans were the major WSC present in all plant tissues
tested (Fig. 5). Younger tissues (ELB and IS) accumulated more soluble carbohydrates than
older ones (MS and ES) (Fig. 5). Following defoliation, carbohydrate levels decreased in the
four plant tissues. Nevertheless, in ES, the decrease in WSC contents was less prominent drastic
than in the other tissues (Fig. 5). The decrease of fructan, sucrose and glucose levels was much
more prominent in young tissues (ELB and IS) than in old ones (MS and ES). Overall, the
decrease of fructose content was slower than that of glucose, suggesting that the fructose release
from fructan breakdown partially balanced the subsequent use of fructose.
Before defoliation, total FEH activity was low in all leaf tissues, while 1-SST activity was
higher in young tissues (ELB and IS) than in older tissues (Fig. 6). Following defoliation, total
FEH activity strongly increased in young tissues, especially in ELB where it rised 10 times in
24 h. It also increased in the other tissues but to a much lesser extent (Fig. 6). Conversely, 1SST activity decreased in all tissues during the first 12 h of regrowth and remained low
afterwards.
Before defoliation, the transcript levels of Lp6-FEHa, Lp1-FEHa and Lp1-SST were much
higher in ELB than in leaf sheaths with a decreasing gradient from the youngest to the oldest
tissue (Fig. 7). By contrast, the transcript level of Lp6G-FFT was similar for all leaf tissues and
that of Lp6-SFT was the lowest in ELB and the highest in MS. In all plant tissues tested,
transcript levels of FT s genes (Lp6G-FFT, Lp1-SST and Lp6-SFT) dropped dramatically after
defoliation. They were already very low at 12 h after defoliation and remained stable afterwards
(Fig. 7). Conversely, both Lp6-FEHa and Lp1-FEHa transcript levels decreased only slowly in
ELB and in IS, and their levels were still relatively high in these young tissues after 12 h of
regrowth (Fig. 7).
Discussion
Perennial ryegrass plants synthesize β(2,1) and β(2,6) linked fructans (Pavis et al. 2001). As a
consequence, different FEH types are needed to efficiently degrade such complex mixture. In
this species, a 6-FEH enzyme has been purified to homogeneity (Marx et al. 1997) and a 1-FEH
cDNA named Lp1-FEHa had been cloned before (Lothier et al. 2007). In this study, we present
the first cloning of a 6-FEH cDNA from L. perenne.
Deduced amino acid sequence of Lp6-FEHa
The Lp6-FEHa deduced protein sequence contains the three conserved motifs ND25PCG,
FRD150P and WE205CPD of GH32. Asp 25 probably acts as nucleophile, Glu 205 as acid/base
catalyst and Asp 150 as transition-state stabilizer (Lammens et al. 2009). Signal3P software
predicts that Lp6-FEHa has a hydrophobic N-terminal signal sequence of 20 amino acids
required for cotranslational insertion in the endoplasmic reticulum (Bendtsen et al. 2004). This
signal peptide is followed by a propeptide estimated at 19 amino acids by comparison with the
estimated length of mature enzyme based on the N-terminal sequence of other 1-FEH mature
proteins (Van den Ende et al. 2001, 2003a). Such propeptides may harbour signals for vacuolar
targeting (Vitale and Hinz 2005), but this should be further investigated.
Accordingly to the theory that FEHs and FTs are derived from cell wall and vacuolar invertases,
respectively (Van den Ende et al. 2002), Lp6-FEHa groups with monocot cell wall invertases
and not with monocot FTs. Analysis of the phylogenetic tree points out that apart from wheat
and timothy 6-FEHs, all other FEHs from monocots belong to the same group (i.e. 1-FEHs
from wheat, perennial ryegrass, Bromus pictus; 6-KEHs from wheat; 6&1-FEH from wheat and
Lp6-FEHa from perennial ryegass).
Enzymatic properties
The recombinant Lp6-FEHa was therefore expressed in P. pastoris for functional
characterization. The validity of this heterologous expression system is now recognized since
previous studies showed that recombinant FEHs have similar characteristics as their native
counterparts (De Coninck et al. 2005; Van Riet et al. 2006). The recombinant Lp6-FEHa
showed the highest activity against β(2,6) linked fructans notably against 6-kestotriose and,
although to a lesser extent, also against bacterial levan and 6G-kestotriose, while it had very
low activity against β(2,1) linked fructans. These results clearly demonstrate that Lp6-FEHa
prefers β(2,6) linked fructan oligosaccharides. Regarding its substrate specificity, Lp6-FEHa is
close to the proteins termed 6-FEHs such as those purified from oat, L. perenne, sugar beet and
Arabidopsis since all of them attack preferentially β(2,6) linked fructans but are also able to
attack β(2,1) linked oligofructans to a certain extent (Henson and Livingston 1996; Marx et al.
1997; Van den Ende et al. 2003b; De Coninck et al. 2005).
Typically for plant FEHs, the recombinant Lp6-FEHa showed almost no activity against
sucrose (Table 1). This result clearly demonstrates that this enzyme is not an invertase
but a true FEH. Among all plant FEHs identified so far, many, but not all, are inhibited
by sucrose, either strongly or weakly (summarized in Van den Ende et al. 2009). Like
the 6-FEH purified from L. perenne (Marx et al. 1997) and other 1-FEHs from different
plant species (Van den Ende et al. 2000; 2003a; Lothier et al. 2007; Asega et al. 2008)
but contrary to 6-FEHs from timothy (Tamura et al. 2011), wheat (Van Riet et al. 2006),
Arabidopsis (De Coninck et al. 2005) and sugar beet (Van den Ende et al. 2003b),
Lp6-FEHa is strongly inhibited by sucrose. Site directed mutagenesis on a cell wall
invertase (AtcwINV1) and FEH (Ci1-FEH IIa), and use of inhibitors demonstrated that
sucrose can bind in the inhibitor or substrate configuration, depending on specific
amino acids present in the vicinity of the active site (Verhaest et al. 2007). The binding
of sucrose in the inhibitory configuration in chicory 1-FEH IIa is determined by the
specific orientation of a single amino acid Trp82 of the highly conserved WSGSAT
motif, being itself influenced by Ser101 (Fig. 2). Replacement of Trp82 or Ser101 by a
leucine resulted in the loss of sucrose inhibition (Verhaest et al. 2007) and by the gain
of invertase activity (Le Roy et al. 2008). The authors proposed a relationship between
sucrose inhibition and amino acid composition. FEHs with a small amino acid, such as
glycine (in Lp1-FEHa, Ki = 2.8 mM, Lothier et al. 2007) or serine (in Ci1-FEH IIa, Ki =
5.9 mM, De Roover et al. 1999) at the corresponding site of Ser101 (in Ci1-FEH IIa)
were strongly inhibited by sucrose, whereas those with glutamine, valine, leucine,
isoleucine ( Pp6-FEH1, Tamura et al. 2011) or arginine were weakly (Verhaest et al.
2007) or not inhibited (Van Riet et al. 2006) by sucrose. Since Lp6-FEHa is strongly
inhibited by sucrose (similarly to Ci1-FEH IIa), a glycine or a serine was expected at
the corresponding site of Ser101. However, an arginine is present (Fig. 2), as in the
wheat 6-FEH which is not inhibited by sucrose (Van Riet et al. 2006). This suggests
that some other amino acid(s) in the vicinity may play a crucial role in the binding of
sucrose in its inhibitory configuration, but this requires further research.
Function and regulation of Lp6-FEHa
Grasses accumulate (2,1) and (2,6) linked fructans and the predominant linkage is (2,6)
(Chatterton et al. 1990; Cairns and Ashton 1993). Fructans are depolymerized by 6-FEH and 1FEH enzymes following source-sink modifications such as cutting or grain-filling (Prud'homme
et al. 1992; Schnyder 1993; Morvan-Bertrand et al. 1999, 2001). In addition to their obvious
function in fructan degradation when energy and carbon skeletons are needed, 6-FEHs together
with 1-FEHs may also indirectly contribute to abiotic stress tolerance since the increase of
oligofructan concentrations probably aims to regulate the cell osmotic potential and/or to
stabilize membranes during frost or drought (Hincha et al. 2002; Livingston et al. 2009). Cold
stress can induce FEHs for partial hydrolysis of high DP fructans to lower DP fructans (Del
Viso et al. 2009; Asega et al. 2011), thus providing an optimal mixture of carbohydrates for
membrane protection or osmotic adjustment.
The large increase of FEH activity following defoliation of L. perenne can be partly repressed
by supply of glucose and mannose but not of 3-O-methylglucose (Lothier et al. 2010)
suggesting that the glucose excess before defoliation is sensed by hexokinase mitigating FEH
transcription and maintaining total FEH activities at a low level together with the direct
inhibitory effect of sucrose at the protein level (see also below). After defoliation, the increase
of FEH activity in ELB and IS occurred in parallel with a sharp decrease in glucose content
which could be sensed as a sugar starvation by SNF1-related protein kinase1 (SnRK1), a central
integrator of stress and energy signaling in plants (Smeekens et al. 2010). However, the exact
underlying mechanisms by which FEH activity increases following defoliation is regulated
remain unknown. Surprisingly and as already reported for Lp1-FEHa (Lothier et al. 2007), Lp6FEHa transcript levels did not increase but instead decreased following defoliation. Therefore,
in response to defoliation, both Lp6-FEHa and Lp1-FEHa gene expression were downregulated. To compensate their down-regulation at the transcriptional level, other FEH forms
might be upregulated or additional mechanisms at the post-transcriptional level might occur
(see also below) to account for the total FEH activity increase.
In undefoliated plants, Lp6-FEHa, Lp1-FEHa and Lp1-SST relative transcript levels followed
the same patterns, being much higher in internal younger tissues than in external older tissues.
Similarly, by following transcript levels along the longitudinal axis of elongating leaves, strong
gradients of transcript levels from high level in young basal tissues to low levels in older upper
tissues were observed in L. perenne for Lp1-FEHa (Lothier et al. 2007) and Lp1-SST (Lasseur
et al. 2006), suggesting a transcriptional regulation of these genes depending on cell age.
Conversely, Lp6G-FFT and Lp6-SFT transcript levels did not decrease from internal to external
leaf tissues while they both follow a declining gradient from base to top of elongating leaves
(Lasseur et al. 2006, 2011). These observations indicate a complex regulation of FEH and FT
expression by cell age and maturity in leaves.
Interestingly, in tissues where fructans accumulate to the highest extent and where total FEH
activity increased after defoliation (ELB and IS), Lp6-FEHa and Lp1-FEHa transcript levels
did not decline as drastically as in other tissues. Overall, FEH transcript declines were far less
prominent as compared to those of the FT (6G-FFT, 6-SFT and 1-SST) transcripts (Fig. 7).
Transcript levels are the result of transcription rate and mRNA decay. Since FT regulation
mainly occurs at the transcriptional level (Sprenger et al. 1995; Nagaraj et al. 2004), the
decrease of FT activities following defoliation may be due to a high FT mRNA decay.
Conversely, the slower decline of FEH transcript levels suggests that corresponding mRNAs
may have a higher stability (slower decay). This suggestion is consistent with a previous study
in orchardgrass reporting that the 6-FEH activity increase after defoliation was only sligthly
affected by transcriptional inhibitors (Yamamoto and Mino 1989). By contrast, the supply of
protein synthesis inhibitors drastically suppressed the uprise of 6-FEH activity (Yamamoto and
Mino, 1989). These data indicate that in orchardgrass FEH gene transcription was not needed
for the increase of FEH activity after defoliation but protein synthesis was required. In
eukaryotes, including plants, cytoplasmic RNA decay takes place in RNA–protein complexes
called processing bodies (P-bodies; Coller and Parker, 2004; Xu and Chua, 2011). In yeast,
highly expressed mRNA can be sequestered in P-bodies for future regulation (decay or
translation) (Lavut and Raveh, 2012). If such a mechanism exists in plants, perennial ryegrass
plants might keep a pool of FEH transcripts available for translation during the first hours of
regrowth. In grasses adapted to defoliation, such regulation of mRNA stability may represent a
strategy to save energy and quickly adjust fructan metabolism to the increased cellular demands
after drastic and sudden defoliation, when saving energy is crucial for plant survival. It can not
be excluded, however, that one or several currently unknown L. perenne 6-FEH isozymes are
up-regulated at the transcriptional level after defoliation. Indeed, Lp6-FEHa and the 6-FEH
purified by Marx et al. (1997) from L. perenne are probably two distinct isoforms. Their pIs are
different, 4.7 for the purified 6-FEH (Marx et al. 1997) and 5.5 for the recombinant Lp6FEHa.
Morevover, the purified 6-FEH from Marx et al. (1997) has a relatively high activity against
6G-kestotriose (63% compared to that against 6-kestotriose) while the Lp6-FEHa presented
here has a very low activity against 6G-kestotriose (17% compared to that against 6kestotriose). Since such differences have not been reported when recombinant FEHs were
compared to their native forms (De Coninck et al. 2005; Van Riet et al. 2006), they cannot be
attributed to the glycosylation patterns of the enzymes. They rather suggest that Lp6-FEHa and
the purified 6-FEH correspond to distinct isoenzymes that might be differentially regulated.
In addition to regulation involving de novo protein synthesis, FEH activity increases may also
result from specific regulation at the protein level. The similarity between FEHs and cell wall
invertases suggests that FEH activities might be controlled by proteinaceous inhibitors (Rausch
and Greiner 2004). Whether FEHs are subjected to such regulation via inhibitory proteins
remains to be demonstrated. If such FEH inhibitors exist, they would rather be FEH-specific as
high concentrations of invertase inhibitors did not affect FEH activities (Kusch et al. 2009).
Besides, activity of FEHs is known to be controlled by sucrose levels. Indeed, since Lp6-FEHa
activity is strongly inhibited by sucrose in vitro, the decrease of sucrose level after defoliation
could lead to the increase of Lp6-FEHa activity in planta, assuming that Lp6-FEHa and sucrose
colocalize in the same compartment. The Ki for sucrose for the strongly inhibited FEHs (< 6
mM, Van den Ende et al. 2009) is well below the usual physiological sucrose concentration
measured in plant vacuoles (100 mM, Pollock 1986; 20 mM, Winter et al. 1993), suggesting
that sucrose can act as an active site inhibitor of Lp6-FEHa activity, provided that the enzyme
operates in the vacuole. In the apoplast, sucrose concentration is expected to be low (1.5 to 10
mM in winter oat; Livingston and Henson 1998). Thus, sucrose may not act as a strong inhibitor
of Lp6-FEH activity if the enzyme would operate in the apoplast. The major advantage of
strong sucrose inhibition of FEH activity is a rapid shift from net fructan biosynthesis to net
fructan degradation when sucrose amounts decrease as a result of defoliation or, the other way
around, from net fructan degradation to net fructan synthesis when sucrose amounts increase.
Contrary to L. perenne (Lee et al. 2008), timothy is poorly persistent to frequent defoliation
(Casler 2005). Interestingly, Pp6-FEH1, which is believed to play a major role in fructan
degradation after defoliation, is only weakly inhibited by sucrose, but needs to be de novo
synthesized via induction of transcription (Tamura et al. 2011), a process that perhaps requires
too much time and energy to allow persistent defoliation in timothy. It would be of interest to
determine whether differences in the regulation of FEH activities (sucrose inhibition, mRNA
stability and sequestration) amongst forage grass species can be linked to their regrowth
capacity and, more generally, to their tolerance to defoliation.
Conclusion
In this study, the first cDNA termed Lp6-FEHa, encoding a genuine 6-FEH from perennial
ryegrass, has been cloned. Based on its strong inhibition by sucrose, the Lp6-FEHa isoform is
expected to be de-inhibited by sucrose depletion and involved in fructan breakdown in tiller
bases following defoliation. However, other FEH isoforms and/or mechanisms might also be
involved. These FEHs could be very useful for transgenic or breeding approaches to increase
fructan breakdown efficiency in grassland species to improve pasture yield and perennity.
As a future goal and to go further in the regulation and localization of fructan metabolism,
investigations of additional 6-FEH isozymes as well as production of specific antibodies are in
progress.
Acknowledgments
This work was supported by FWO (Fonds voor Wetenschappelijk Onderzoek Vlaanderen,
Brussels, Belgium), the MESR (Ministère de l’Enseignement Supérieur et de la Recherche,
France) [Doctoral fellowship to J.L.], UCBN (Université de Caen Basse-Normandie, France),
INRA (Institut National de la Recherche Agronomique), the PHC (Programme Hubert Curien)
Tournesol France-Belgium [11515WD].
Conflict of interest
The authors declare that they have no conflict of interest.
References
Asega AF, do Nascimento JR, Schroeven L, Van den Ende W, Carvalho MA (2008) Cloning,
characterization and functional analysis of a 1-FEH cDNA from Vernonia herbacea (Vell.)
Rusby. Plant Cell Physiol 49:1185–1195
Asega AF, do Nascimento JR, Carvalho MA (2011) Increased expression of fructan 1exohydrolase in rhizophores of Vernonia herbacea during sprouting and exposure to low
temperature. J Plant Phys 168: 558–565
Bachmann M, Matile P, Keller F (1994) Metabolism of the raffinose family
oligosaccharides in leaves of Ajuga reptans L. Plant Physiol 105:1335–1345
Ballard RA, Simpson RJ, Pearce GR (1990) Losses of the digestible components of
annual ryegrass (Lolium rigidum Gaudin) during senescence. Austr J Agr Res 41:719–
731
Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal
peptides: SignalP 3.0. J Mol Biol 340:783–795
Blake JD, Clarke ML, Jansson PE, McNeil KE (1982) Fructan from Erwinia herbicola. J
Bacteriol 151:1595–1597
Cairns AJ, Ashton JE (1993) Species-dependent patterns of fructan synthesis by
enzymes from excised leaves of oat, wheat, barley and timothy. New Phytol 124:381–
388
Casler MD (2005) Agronomic performance of timothy germplasm from forage and turf
sods under two harvest managements. Crop Sci 45:1990–1996
Chatterton NJ, Harrison PA, Thornley WR, Draper EA (1990) Oligosaccharides in
foliage of Agropyron, Bromus, Dactylis, Festuca, Lolium and Phleum. New Phytol
114:167–171
Coller J, Parker R (2004) Eukaryotic mRNA decapping. Annu Rev Biochem 73:861–
890
Del Viso F, Puebla AF, Hopp HE, Heinz RA (2009) Cloning and functional characterization of a
fructan 1-exohydrolase (1-FEH) in the cold tolerant Patagonian species Bromus pictus. Planta
231:13–25
De Coninck B, Le Roy K, Francis I, Clerens S, Vergauwen R, Halliday AM, Smith SM,
Van Laere A, Van den Ende W (2005) Arabidopsis AtcwINV3 and 6 are not invertases
but are fructan exohydrolases (FEHs) with different substrate specificities. Plant Cell
Environ 28:432–443
De Roover J, De Winter M, Van Laere A, Timmermans J, Van den Ende W (1999)
Purification and properties of a second fructan exohydrolase from the roots of
Cichorium intybus L. Physiol Plant 106:28–34
Hendry G (1993) Evolutionary origins and natural functions of fructans: a
climatological, biogeographic and mechanistic appraisal. New Phytol 123:3–14
Henson CA, Livingston DP III (1996) Purification and characterization of an oat fructan
exohydrolase that preferentially hydrolyzes β-2,6-fructans. Plant Physiol 110:639–644
Henson CA, Livingston DP III (1998) Characterization of a fructan exohydrolase
purified from barley stems that hydrolyzes multiple fructofuranosidic linkages. Plant
Physiol Biochem 36:715–720
Hincha DK, Zuther E, Hellwege EM, Heyer AG (2002) Specific effects of fructo- and
gluco-oligosaccharides in the preservation of liposomes during drying. Glycobiology
12:103–110
Joudi M, Ahmadi A, Mohamadi V, Abbasi A, Vergauwen R, Mohamadi H, Van den
Ende W (2012) Comparison of fructan dynamics in two wheat cultivars with different
capacities of accumulation and remobilization under terminal drought stress. Physiol
Plant 144:1–12
Kawakami A, Yoshida M, Van den Ende W (2005) Molecular cloning and functional
analysis of a novel 6&1-FEH from wheat (Triticum aestivum L.) preferentially degrading
small graminans like bifurcose. Gene 358:93–101
Kawakami A, Sato Y, Yoshida M (2008) Genetic engineering of rice capable of
synthesizing fructans and enhancing chilling tolerance. J Exp Bot 59:793–802
Kusch U, Harms K, Rausch T, Greiner S (2009) Inhibitors of plant invertases do not affect the
structurally related enzymes of fructan metabolism. New Phytol 181:601–612
Lammens W, Le Roy K, Schroeven L, Van Laere A, Rabjins A, Van den Ende W (2009)
Structural insights into glycoside hydrolase family 32 and 68 enzymes: functional implications.
J Exp Bot 60:727–740
Lasseur B, Lothier J, Djoumad A, De Coninck B, Smeekens S, Van Laere A, MorvanBertrand A, Van den Ende W, Prud'homme M-P (2006) Molecular and functional
characterization of a cDNA encoding fructan:fructan 6G-fructosyltransferase (6GFFT)/fructan:fructan 1-fructosyltransferase (1-FFT) from perennial ryegrass (Lolium
perenne L). J Exp Bot 57:2719–2734
Lasseur B, Lothier J, Wiemken A, Van Laere A, Morvan-Bertrand A, Van den Ende W,
Prud'homme M-P (2011) Towards a better understanding of the generation of fructan structure
diversity in plants: molecular and functional characterization of a sucrose:fructan 6fructosyltransferase (6-SFT) cDNA from perennial ryegrass (Lolium perenne). J Exp Bot
62:1871–1885
Lavut A, Raveh D (2012) Sequestration of highly expressed mRNAs in cytoplasmic
granules, P-bodies, and stress granules enhances cell viability. PLoS Genet,
8:e1002527
Lee JM, Donaghy DJ, Roche JR (2008) Effect of defoliation severity on regrowth and
nutritive value of perennial ryegrass dominant swards. Agron J 100:308–314
Le Roy K, Lammens W, Verhaest M, De Coninck B, Rabijns A, Van Laere A, Van den
Ende W
(2007) Unraveling the difference between invertases and fructan
exohydrolases: a single amino acid (Asp-239) substitution transforms Arabidopsis cell
wall invertase1 into a fructan 1-exohydrolase. Plant Physiol 145:616–625
Le Roy K, Lammens W, Van Laere A, Van den Ende W (2008) Influencing the binding
configuration of sucrose in the active site of chicory fructan 1-exohydrolase and sugar
beet fructan 6-exohydrolase. New Phytol 178:572–580
Le Roy K, Vergauwen R, Struyf T, Yuan S, Lammens W, Matrai J, De Maeyer M, Van
den Ende W (2013) Understanding the role of defective invertase in plants: tobacco
Nin88 fails to degrade sucrose. Plant Physiol 161:1670–1681
Livingston DP III, Henson CA (1998) Apoplastic sugars, fructans, fructan exohydrolase,
and invertase in winter oat: responses to second-phase cold hardening. Plant Physiol
116:403–408
Livingston DP III, Hincha DK, Heyer AG (2009) Fructan and its relationship to abiotic stress
tolerance in plants. Cell Mol Life Sci 66:2007–2023
Lothier J, Lasseur B, Djoumad A, Le Roy K, Van Laere A, Prud'homme M-P, Barre P,
Van den Ende W, Morvan-Bertrand A (2007) Cloning, gene mapping and functional
analysis of a fructan 1-exohydrolase (1-FEH) from Lolium perenne rather implicated in
fructan synthesis than in fructan mobilization. J Exp Bot 58:1969–1983
Lothier J, Lasseur B, Morvan-Bertrand A, Prud'homme M-P (2010) Hexokinase
dependent sugar signaling represses fructan exohydrolase (FEH) activity in Lolium
perenne. Funct Plant Biol 37:1151–1160
Marx SP, Nösberger J, Frehner M (1997) Hydrolysis of fructan in grasses: a β-(2-6)linkage specific fructan-beta-fructosidase from stubble of Lolium perenne. New Phytol
135:279–290
Michiels A, Van Laere A, Van den Ende W, Tucker M (2004) Expression analysis of a
chicory fructan 1-exohydrolase gene reveals complex regulation by cold. J Exp Bot
55:1325–1333
Morvan-Bertrand A, Boucaud J, Le Saos J, Prud'homme M-P (2001) Roles of the
fructans from leaf sheaths and from the elongating leaf bases in the regrowth following
defoliation of Lolium perenne L. Planta 213:109–120
Morvan-Bertrand A, Boucaud J, Prud'homme M-P (1999) Influence of initial levels of
carbohydrates, fructans, nitrogen, and soluble proteins on regrowth of Lolium perenne
L. cv. Bravo following defoliation. J Exp Bot 50:1817–1826
Morvan A, Challe G, Prud'homme M-P, Le Saos J, Boucaud J (1997) Rise of fructan
exohydrolase activity in stubble of Lolium perenne after defoliation is decreased by
uniconazole, an inhibitor of the biosynthesis of gibberellins. New Phytol 136:81–88
Nagaraj VJ, Altenbach D, Galati V, Lüscher M, Meyer AD, Boller T, Wiemken A (2004)
Distinct
regulation
of
sucrose:sucrose-1-fructosyltransferase
(1-SST)
and
sucrose:fructan-6-fructosyltransferase (6-SFT), the key enzymes of fructan synthesis in
barley leaves: 1-SST as the pacemaker. New Phytol 161:735–748
Pavis N, Chatterton NJ, Harrison PA, Baumgartner S, Praznik W, Boucaud J,
Prud'homme M-P (2001) Structure of fructans in roots and leaf tissues of Lolium
perenne. New Phytol 150:83–95
Peshev D, Vergauwen R, Moglia A, Hideg E, Van den Ende W (2013) Towards
understanding vacuolar antioxidant mechanisms: a role for fructans? J Exp Bot
64:1025–1038
Peshev D, Van den Ende W (2014) Fructans: Prebiotics and immunomodulators. J
Funct Foods. 8:348–357.
Pilon-Smits EAH, Terry N, Sears T, van Dun K (1999) Enhanced drought resistance in
fructan-producing sugar beet. Plant Physiol Bioch 37:313–317
Pollock CJ (1986) Fructans and the metabolism of sucrose in vascular plants. New
Phytol 104: 1–24
Prud'homme M-P, Gonzalez B, Billard J, Boucaud J (1992) Carbohydrate content,
fructan and sucrose enzyme activities in roots, stubble and leaves of ryegrass (Lolium
perenne L.) as affected by source/sink modification after cutting. J Plant Physiol
140:282–291
Rausch T, Greiner S (2004) Plant protein inhibitors of invertases. Bioch Biophys Acta
1696:253–261
Schnyder H (1993) The role of carbohydrate storage and redistribution in the sourcesink relations of wheat and barley during grain filling: a review. New Phytol 123:233–
245
Shiomi N (1981) Purification and characterisation of 6G-fructosyltransferase from the
roots of asparagus (Asparagus officinalis L.). Carbohydr Res 96:281–292
Smeekens S, Ma J, Hanson J, Rolland F (2010) Sugar signals and molecular networks
controlling plant growth. Curr Opin Plant Biol 13:274–279.
Sprenger N, Bortlik K, Brandt A, Boller T, Wiemken A (1995) Purification, cloning, and
functional expression of sucrose:fructan 6-fructosyltransferase, a key enzyme of
fructan synthesis in barley. Proc Natl Acad Sci USA 92:11652–11656
Tamura KI, Sanada Y, Tase K, Komatsu T, Yoshida M (2011) Pp6-FEH1 encodes an enzyme for
degradation of highly polymerized levan and is transcriptionally induced by defoliation in
timothy (Phleum pratense L.). J Exp Bot 62:3421–3431
Van den Ende W (2013) Multifunctional fructans and raffinose family oligosaccharides Front
Plant Sci 4:1–10
Van den Ende W, Clerens S, Vergauwen R, Van Riet L, Van Laere A, Yoshida M,
Kawakami A (2003a) Fructan 1-exohydrolases β-(2,1)-trimmers during graminan
biosynthesis in stems of wheat? Purification, characterization, mass mapping, and
cloning of two fructan 1-exohydrolase isoforms. Plant Physiol 131:621–631
Van den Ende W, De Coninck B, Clerens S, Vergauwen R, Van Laere A (2003b)
Unexpected presence of fructan 6-exohydrolases (6-FEHs) in non-fructan plants:
characterization, cloning, mass mapping and functional analysis of a novel "cell-wall
invertase-like" specific 6-FEH from sugar beet (Beta vulgaris L.). Plant J 36:697–710
Van den Ende W, El-Esawe SK (2013) Sucrose signalling pathways leading to fructan and
anthocyanin accumulation: A dual function in abiotic and biotic stress responses? Environ Exp
Bot (in press) http://dx.doi.org/10.1016/j.envexpbot.2013.09.017
Van den Ende W, Lammens W, Van Laere A, Schroeven L, Le Roy K (2009) Donor and
acceptor substrate selectivity among plant glycoside hydrolase family 32 enzymes. FEBS J
276:5788–5798
Van den Ende W, Michiels A, De Roover J, Van Laere A (2002) Fructan biosynthetic
and breakdown enzymes in dicots evolved from different invertases: expression of
fructan genes throughout chicory development. The Scientific World Journal 2:1273–
1287
Van den Ende W, Michiels A, De Roover J, Verhaert P, Van Laere A (2000) Cloning
and functional analysis of chicory root fructan 1-exohydrolase I (1-FEH I): a vacuolar
enzyme derived from a cell-wall invertase ancestor? Mass fingerprint of the 1-FEH I
enzyme. Plant J 24:447–456
Van den Ende W, Michiels A, Van Wonterghem D, Clerens SP, De Roover J, Van
Laere AJ (2001) Defoliation induces fructan 1-exohydrolase II in witloof chicory roots
Cloning and purification of two isoforms, fructan 1-exohydrolase IIa and fructan 1exohydrolase IIb Mass fingerprint of the fructan 1-exohydrolase II enzymes. Plant
Physiol 126:1186–1195
Van den Ende W, Van Laere A (1996) Fructan synthesizing and degrading activities in
chicory roots (Cichorium intybus L) during growth, storage and forcing. J Plant Physiol
149:43–50
Van den Ende W, Yoshida M, Clerens S, Vergauwen R, Kawakami A (2005) Cloning,
characterization and functional analysis of novel 6-kestose exohydrolases (6-KEHs)
from wheat (Triticum aestivum). New Phytol 166:917–932
Van Laere A, Van den Ende W (2002) Inulin metabolism in dicots: chicory as a model
system. Plant Cell Environ 25:803–813
Van Riet L, Nagaraj V, Van den Ende W, Clerens S, Wiemken A, Van Laere A (2006)
Purification, cloning and functional characterization of a fructan 6-exohydrolase from
wheat (Triticum aestivum L.). J Exp Bot 57:213–223
Van Riet L, Altenbach D, Vergauwen R, Clerens S, Kawakami A, Yoshida M, Van den
Ende W, Wiemken A, Van Laere A (2008) Purification, cloning and functional
differences of a third fructan 1-exohydrolase (1-FEHw3) from wheat (Triticum aestivum
L.). Physiol Plant 133:242–253
Verhaest M, Lammens W, Le Roy K, De Ranter CJ, Van Laere A, Rabijns A, Van den
Ende W (2007) Insights into the fine architecture of the active site of chicory fructan 1exohydrolase: 1-kestose as substrate vs sucrose as inhibitor. New Phytol 174:90–100
Vitale A, Hinz G 2005 Sorting of proteins to storage vacuoles: how many mechanisms?
Trends Plant Sci 10: 316–323
Vogt L, Ramasamy U, Meyer D, Pullens G, Venema K, Faas MM, Schols HA, de Vos P
(2013) Immune modulation by different types of β2→1-fructans is toll-like receptor
dependent. PloS ONE 8: e68367
Volenec JJ (1986) Nonstructural carbohydrates in stem base components of tall fescue
during regrowth. Crop Sci 26:122–127
Wagner W, Wiemken A (1986) Properties and subcellular localization of fructan
hydrolase in the leaves of barley (Hordeum vulgare L. cv Gerbel). J Plant Physiol
123:429–439
Wagner W, Wiemken A (1989) Fructan metbolism in expanded primary leaves of
barley (Hordeum vulgare L. cv Gerbel): change upon ageing and spatial organization
along the leaf blade. J Plant Physiol 134:237–242
Winter H, Robinson D, Heldt H (1993) Subcellular volumes and metabolite
concentrations in barley leaves. Planta, 49:180–190
Xu J, Chua NH (2011) Processing bodies and plant development. Curr Opin Plant Biol.
14:88–93
Yamamoto S, Mino Y (1989) Mechanism of phleinase induction in stem base of
orchardgrass after defoliation. J Plant Physiol 69:258–260
Zhang J, Dell B, Conocono E, Waters I, Setter T, Appels R (2009) Water deficit in
wheat: fructan exohydrolase (1-FEH) mRNA expression and relationship to soluble
carbohydrate concentration in two varieties. New Phytol 181:843–850
Legends to figures
Fig. 1 Schematic view of a Lolium perenne (perennial ryegrass) tiller. For results shown in Fig.
5-6-7, elongating leaf bases (ELB), and mature leaf sheaths decomposed in inner sheaths (IS),
medium sheaths (MS) and external sheaths (ES) were dissected For results shown in Fig. 7,
elongating leaf bases and whole mature leaf sheaths were dissected
Fig. 2 Comparison of the deduced amino acid sequences of Lolium perenne Lp6-FEHa
(EU219846), Lp1-FEHa (DQ016297), timothy Pp6-FEH1 (AB583555), wheat 6&1-FEH
w1 (Ta6&1-FEHw1; AB089269), 6-KEHw1 (Ta6-KEHw1; AB089270) and 6-FEH (Ta6FEH; AM075205), chicory 1-FEHIIa (AJ295033) Asteriks, colons and periods -indicate
identical residues, conserved substitutions and semi-conserved substitutions The βfructosidase motif (NDPXG) and the FRDP and [EC(V/P)D] regions are boxed The
three carboxylic acids implicated in catalysis are in bold The Trp homologous to Trp82
of chicory 1-FEH IIa is indicated by ▼ and the amino acids homologous to Ser101 of
chicory 1-FEH IIa (Verhaest et al 2007) are boxed in grey The potential glycosylation
sites are underlined The estimated end of the peptide signal is indicated by an open
arrow The estimated first amino acid of Lolium perenne Lp6-FEHa mature enzyme is
indicated by a black arrow
Fig. 3 Phylogenetic tree of FEH, cell wall invertases (Cw-INV), fructosytransferases
(FT) and vacuolar invertases (V-INV) of plants based on predicted amino acid
sequences (ClustalW/Drawtree) The Lolium perenne Lp6-FEHa is boxed FEH:
Arabidopsis thaliana 6-FEH (AB029310); Arabidopsis thaliana 6&1-FEH (AY060553);
Arctium lappa 1-FEH (AB611034); Beta vulgaris 6-FEH (AJ508534); Bromus pictus 1FEH (GQ247882); Campanula rapunculoides 1-FEH (AJ509808); Cichorium intybus 1FEH (Y11124); Cichorium intybus 1-FEHI (AJ242538); Cichorium intybus 1-FEHIIa
(AJ295033); Cichorium intybus 1-FEHIIb (AJ295034); Lolium perenne 1-FEHa
(DQ016297); Lolium perenne 6-FEHa (EU219846); Phleum pratense 6-FEH1
(AB583555); Triticum aestivum 1-FEHw1 (AJ516025); Triticum aestivum 6-FEH
(AM075205); Triticum aestivum 6&1-FEH (AB089269); Triticum aestivum 6-KEHw1
(AB089271); Triticum aestivum 6-KEHw2 (AB089270); Vernonia herbacea 1-FEH
(AM231149) Cw-INV: Agave tequilana Cw-INV1 (JN790057); Asparagus officinalis CwINV (AB244731); Arabidopsis thaliana Cw-INV1 (X74514); Beta vulgaris Cw-INV2
(AJ277458); Chenopodium rubrum Cw-INV (X81792); Daucus carota Cw-INV1
(M58362); Fragaria ananassa Cw-INV (AF000521); Hordeum vulgare Cw-INV1
(AJ534447); Lolium perenne Cw-INV (DQ073969); Oryza sativa Cw-INV1 (AY578158);
Oryza sativa Cw-INV2 (AY578159); Oryza sativa Cw-INV4 (AY578161); Oryza sativa
Cw-INV5 (AY578162); Pisum sativum Cw-INV (AF063246); Solanum lycopersicum
Cw-INV5 (AJ272304); Triticum aestivum Cw-INV (AF030420); Vicia faba Cw-INV2
(Z35163); Zea mais Cw-INV2 (AF050128); Zea mais Cw-INV4 (AF043347) FT: Agave
tequilana 1-SST (DQ535031); Allium cepa 1-SST (AJ006066); Allium cepa 6G-FFT
(Y07838);
Asparagus
officinalis
6G-FFT
(AF084283);
Bromus
pictus
6-SFT
(FJ424612); Festuca arundinacea 1-SST (AJ297369); Hordeum vulgare 6-SFT
(X83233); Lolium perenne 1-SST (AY245431); Lolium perenne 6-SFT (AF494041);
Lolium perenne 6G-FFT (AF492836); Phleum pratense 6-SFT (BAH30252); Poa ampla
6-SFT (AF192394); Triticum aestivum 1-SST (AB029888); Triticum aestivum 1-FFT
(AB088409); Triticum aestivum 6-SFT (AB029887) V-INV: Allium cepa V-INV
(AJ006067); Asparagus officinalis V-INV (AF002656); Lolium perenne V-INV
(AY082350); Oryza sativa V-INV (AF276703); Triticum aestivum V-INV (AJ635225);
Zea mais V-INV (P49175) Group I contains FEHs and cell wall invertases from
monocots, group II contains FEHs and cell wall invertases from eudicots and group III
contains FT and vacuolar invertase from monocots
Fig. 4 HPAEC chromatograms of reaction mixtures of the Pichia pastoris expressed
recombinant Lp6-FEHa with native fructans from Lolium perenne after 0, 1, 2 and 24 h of
incubation at 30°C G, glucose; F, fructose; S, sucrose
Fig. 5 Changes in the contents of soluble sugars (fructans, sucrose, glucose and
fructose) in elongating leaf bases (ELB), and mature leaf sheaths decomposed in inner
sheaths (IS), medium sheaths (MS) and external sheaths (ES) of Lolium perenne
during the first 24 h of regrowth Values are means of three replicates. Vertical bars
indicate ± standard error when larger than the symbol
Fig. 6 Total FEH and 1-SST activities in elongating leaf bases (ELB), and mature leaf sheaths
decomposed in inner sheaths (IS), medium sheaths (MS) and external sheaths (ES) of Lolium
perenne during the first 24 h of regrowth. Values are means of three replicates. Vertical bars
indicate ± standard error when larger than the symbol
Fig. 7 Real time qPCR analysis of Lp6-FEHa, Lp1-FEHa, Lp1-SST, Lp6G-FFT and Lp6-SFT
expression in elongating leaf bases (ELB), and mature leaf sheaths decomposed in inner sheaths
(IS), medium sheaths (MS) and external sheaths (ES) of Lolium perenne during the first 24 h of
regrowth Expression levels produced by real-time qPCR are expressed as a ratio relative to the
control point (expression in elongating leaf bases at 0 h). Values are means of three replicates.
Vertical bars indicate ± standard error when larger than the symbol
Table 1 Substrate specificity of the Pichia pastoris expressed recombinant Lp6-FEHa. Substrate
concentration in the enzyme assays was 3 mM for sucrose, 6-kestotriose, 6G-kestoriose, 1kestotriose and 1,1-kestotriose and 5% for bacterial levan, inulin (C. intybus) and high DP
fructans (L. perenne). Relative activity is expressed as the percentage of the activity with 6kestotriose (bold) as substrate. DP, degree of polymerization
Substrate
Linkage type
Sucrose
DP
Relative activity (%)
2
02
6-kestotriose
β(2,6)
3
100
6G-kestotriose
β(2,6)
3
17
Levana (Erwinia herbicola)
Mainly β(2,6)
<100 000b
25
1-kestotriose
β(2,1)
3
11
1,1-kestotetraose
β(2,1)
4
11
Inulin (Cichorium intybus)
β(2,1)
>10
1
High DP fructans (L perenne)
β(2,6) and β(2,1)
>10
15
a
Blake et al. 1982 bMean DP
Table 2 Influence of sucrose on the activity of the Pichia pastoris expressed recombinant Lp6FEHa. Enzymatic assays were done with 6-kestotriose 3 mM as substrate. The rate of fructose
production without sucrose was used as 0 % inhibition of reaction rate
Inhibitor
Inhibitor concentration (mM) Inhibition (%)
None
0
0
Sucrose
10
70
Sucrose
20
80
Sucrose
40
90