Activity
DP Biology
Protein Synthesis
Review:With a partner recap structure of DNA and RNA







Structure of a nucleotide
Differences between RNA and DNA
Complimentary base pairing
Purines/Pyrimidines
What is meant by antiparallel nature of DNA
To which carbon of the sugar is the phosphate group attached
What are nucleotide 3 phosphates needed
Extra notes:
 DNA acts as encyclopedia having all information for the growth of the organism.
 It is termed universal as it is found in all living organisms even viruses
 This information is stored as the sequence of bases in the DNA. Each triplet of bases codes for an amino
acid or start stop message. Each sequence of three bases, found on the mRNA, is called a codon. Since
there are 4 bases and three in each codon there is the possibility of 64 amino acids (4X4X4). In living
things there are only 20 amino acids and therefore there are at least two codons coding for the same
amino acid.
 Therefore the genetic code is referred to as degenerate - having more than one base triplet code for one
amino acid.
 Information is contained in the nucleus whereas protein synthesis occurs on the ribosomes in the
cytoplasm.So information must be able to pass from the nucleus to the cytoplasm and this is achieved
through mRNA
 The copying of the info contained in the DNA to the mRNA is called transcription
 Turning mRNA into a polypeptide chain is termed translation
Transcription
 RNA nucleotides found in the nucleolus are used to make a copy of the DNA with the help of the
enzyme: gyrase, helicase and RNA polymerase.
 The addition of nucleotide occurs in a 5-3 direction (5 end of free RNA nucleotide is added to 3 end of
RNA molecule)
 Only one of the strands of DNA is ever copied – the antisense strand is copied thus the mRNA
produced has the same code as the Sense strand.
 Gyrase is responsible for the unwinding of the DNA
 Then helicase breaks the hydrogen bonds between the complementary base pairs
 Transcription is initiated by a promoter region of DNA and stops when a terminator region is reached.
 RNA polymerase then adds RNA nucleotides using complementary base pairing – G/C – A/U.
Nucleoside triphosphates are used to provide the energy.
 Thus the triplet sequence, codon, GCT on the DNA is translated to CGA on the mRNA and this causes
tRNA to bring on the amino acid arganine.
 Before the m RNA can leave the nucleus it is edited – the introns are removed (non coding part of
mRNA) and the exons remain – this makes the m RNA much shorter and it now only contains the
codons for the amino acids required. (mature RNA).
 mRNA now leaves the nucleus and enters the cytoplasm where it attaches to a ribosome ( ribosomal
RNA).

http://www.biostudio.com/d_%20Transcription.htm
Transcription video clip
Translation

These ribosomes may lie free in the cytoplasm (make proteins for cellular use) or can be found
attached to the ER (proteins for export from cell)

The ribosome is made up of two units a larger and smaller unit. The larger unit attaches to the
tRNA and the smaller unit to the mRNA.

tRNA is now used to bring in the correct amino acids in the correct sequence. The tRNA has a
triplet of bases attached to one side known as the anticodon, these are complementary to the
sequence of bases on the m RNA (codon). The other end of the t RNA is specific to a particular
amino acid.

Therefore the sequence of bases CGA on the m RNA corresponds to GCU on the tRNA. And this
in turn corresponds to the amino acid Arginine.

In this way the correct amino acids are arranged in the correct sequence, resulting in the
production of a particular polypeptide. Thus one complete sequence of codons on the DNA is
translated into a particular polypeptide – the sequence of codons on the DNA is referred to as a
gene. One gene one polypeptide.

To speed the process of protein synthesis up more than one ribosome attaches to each mRNA
thus many polypeptides can be produced at the same time. Several ribosomes make up a
polysome.

http://www.biostudio.com/demo_freeman_protein_synthesis.htm
translation video clip
Extra resources:

http://www.youtube.com/watch?v=NJxobgkPEAo&mode=related&search=
Protein synthesis (transcription and translation) video – the whole thing
Protein Synthesis Activity I:
The following site is for an excellent animation of protein synthesis. The voice over unfortunately is in
Russian! Your challenge is write a suitable voice over and attach it to the video. You will be assigned a
group to complete the task.
http://www.youtube.com/watch?v=5u43efNbq50&mode=related&search=
Protein Synthesis Activity II:

You will be allocated one of the following DNA anti-sense (template) sequence:
1.
AAATACTTCAGCCGGCCCGCT TACACCCATACGGTGATTGGG
2.
ACCTACACCCATACGGTGGGG TACGACTGACTACTCATT
3.
TACTTAGTTGTAAGGCTTACTATCGGACGAAAACTACCGCA

Write out the code for the strand of mRNA produced when your DNA is transcribed

Divide the mRNA sequence into 3 letter codons

What would be the sequence of amino acids in the primary protein structure. The codons below refer to the triplet of
bases on the mRNA and its corresponding amino acid.

Finally list the amino acid sequence in the primary polypeptide chain
It is the sequence of bases on the mRNA that dictates the amino acid produced.
Protein Synthesis Activity III:
1. distinguish between transcription and translation
2. A transcribing DNA strand contains the base sequence CGGAATCGT. What will be the base sequence
in the mRNA transcribed from it?
3. What is the role of tRNA
4. What type of bond attaches a new amino acid to a polypeptide chain?
5. By what process does a tRNA molecule attach onto mRNA during translation?
6. What is a polysome?
7. The distribution of introns has been used in the study of evolution. There are two main schools of
thought: one school believes that introns arose in prokaryotes which subsequently lost them; the other
school believes that introns were acquired by eukaryotes for the first time. Suggest how the following
observations may be used to support either of these schools of thought.
a. introns are not found in prokaryotes
b. introns are found in the nuclear DNA of most Eukaryotes
c. introns occur in the DNA of chloroplasts