Name_____________________________ Date_________________period___
DNA to Proteins activity
1. Finish this DNA sequence by writing in the complimentary base to the one shown:
GCATTTTAAAGGCCTATCTAGCTAGCATATAGCTACGCTACTCAGT
CGTA
2. Create a RNA strand from the DNA code given: (remember Uracil replaces Thymine)
DNA STRAND
RNA STRAND
ATGCCTGACAGTATCGTATCGGATGCCGTAATCCCGGTTAATGCATCCG
UACG
3. DNA transcription to RNA,  RNA translates the message into a protein by attaching the amino acids together into a
long chain according to a genetic code of bases called a codon. Found on page 244 in your textbook.
What is the start codon? (Methionine is the amino acid) ____________
What are the 3 stop codons? ________, ________, _________.
Given the following sequence of RNA translate the code into the protein it will create:
RNA code:AUGCAGUCAGAAUUACAUUUGUAG
Amino acid: MET- GLU- SER(Start codon)
4. On the back of this sheet, create your own 30 amino acid chain protein by
1. Creating the DNA strand (Don’t forget your start and stop codons)
2. Transcribing the RNA
3. Translating the amino acids to make your protein
5. Below show each of the following steps of the DNA to Protein production by explaining it and drawing the step.

1.Transcription
2. mRNA leaves the Nucleus and finds a Ribosome to
attach to (top of pg 246)

4. Polypeptide chain created from the string of amino acids
chosen using the code on the mRNA codon and tRNA
3. The Ribosome and mRNA message is decoded by the
tRNA’ s Anticodon and Amino Acids are bonded (Step #3
on bottom left of page 246)
Name_____________________________ Date_________________period___
DNA to Proteins activity
1. Finish this DNA sequence by writing in the complimentary base to the one shown:
GCATTTTAAAGGCCTATCTAGCTAGCATATAGCTACGCTACTCAGT
CGTA
2. Create a RNA strand from the DNA code given: (remember Uracil replaces Thymine)
DNA STRAND
RNA STRAND
ATGCCTGACAGTATCGTATCGGATGCCGTAATCCCGGTTAATGCATCCG
UACG
3. DNA transcription to RNA,  RNA translates the message into a protein by attaching the amino acids together into a
long chain according to a genetic code of bases called a codon. Found on page 244 in your textbook.
What is the start codon? (Methionine is the amino acid) ____________
What are the 3 stop codons? ________, ________, _________.
Given the following sequence of RNA translate the code into the protein it will create:
RNA code:AUGCAGUCAGAAUUACAUUUGUAG
Amino acid: MET- GLU- SER(Start codon)
4. On the back of this sheet, create your own 30 amino acid chain protein by
4. Creating the DNA strand (Don’t forget your start and stop codons)
5. Transcribing the RNA
6. Translating the amino acids to make your protein
5. Below show each of the following steps of the DNA to Protein production by explaining it and drawing the step.

1.Transcription
2. mRNA leaves the Nucleus and finds a Ribosome to
attach to (top of pg 246)

4. Polypeptide chain created from the string of amino acids
chosen using the code on the mRNA codon and tRNA
3. The Ribosome and mRNA message is decoded by the
tRNA’ s Anticodon and Amino Acids are bonded (Step #3
on bottom left of page 246)