The Molecular Correlates of Organ Loss: The Case of Insect Malpighian Tubules
Supplementary methods
This file provides additional information to the methods provided in the main article.
Experimental insects
The Drosophila were reared at 25 °C under a 12L:12D light cycle on yeast-glucose diet (100 g brewer's yeast [MP 903312, MP Biomedicals, Santa Ana, CA, USA], 100 g glucose [Sigma
158968, St. Louis, MO, USA], 12 g agar [Apex 66-103, Genesee Scientific, San Diego, CA,
USA], 8.4 ml propionic acid and 8 ml phosphoric acid, made up to 1 l by adding water). The pea aphids were reared on Vicia faba cv. Windsor at 20 °C with 18L:6D light cycle.
Sample preparation
RNA was extracted from samples of whole animals (20 Drosophila and 5 pea aphids) and dissected guts (50 Drosophila guts, including the Malpighian tubules, and 60 aphid guts) by the
RNeasy Mini kit (Qiagen) following manufacturer’s instructions, during which genomic DNA was removed by DNase incubation using DNA-Free kit (Ambion). The quality of the extracted
RNA was analyzed by Bioanalyzer 2100 with RIN > 8.5, and the quantity was measured by the
Quant-iT
™
PicoGreen
®
Kit .
RNA-seq analysis
Multiplex library construction with 1 μg RNA followed TruSeq RNA Samples Prep v2 LS
Protocol (Illumina) (electronic supplementary material, table S1 for barcode information).
Briefly, the poly-A RNA was purified using poly-T oligo-attached magnetic beads and then

fragmented. The cleaved RNA was reversely transcribed into ds cDNA with blunt ends. The resulting cDNA was purified from the reaction mixture and used for adaptor ligation. To minimize template concatenation, a complementary overhang was generated by adding one ‘A’ nucleotide and one ‘T’ nucleotide to the 3’ ends of the cDNA and the adapters, respectively, before ligating the adapter. The cDNA with adapter on both ends was further enriched by 15 cycles of PCR amplification. After confirming the quality of the library by Bioanalyzer 2100, and then single-end 100 bp reads were sequenced by Illumina Hi-Seq2000 platform. Reads flagged as low quality in FastQC were removed and reads passing quality filter (“Filter by quality” v. 1.0.0 tool with default parameters) were used for subsequent analysis. TopHat for
Illumina (v.1.5.0) was applied to align the reads to reference genomes of D. melanogaster genome (BDGP 5.25) and A. pisum genome (v. 2.1), and to generate an annotation file with coordinates of gene transcript boundaries [1,2].
Identification of aphid orthologs of Drosophila genes expressed in Malpighian tubules and its expression analysis
Pea aphid orthologs of Drosophila Malpighian tubule genes were identified by the procedure in
Fig. 1( b ), using microarray expression data in Fly Atlas (http://flyatlas.org/) and custom Perl scripts. Briefly, the Drosophila genes enriched (>2 fold) in tubules according to FlyAtlas microarray data (http://www.affymetrix.com/Auth/analysis/downloads/na34/ivt/Drosophila_
2.na34.annot.csv.zip) were collated, and filtered to retain only those genes with expression designated as DOWN or NONE in all other gut tissues (crop, midgut, hindgut) in FlyAtlas and with FPKM >1 in the RNAseq analysis of this study. The filtered gene list comprised our
Drosophila Malpighian tubule gene set. Their sequences were obtained from FlyBase and

aligned to the full set of aphid proteins (AphidBase: ACYPI proteins v2.1b), using BLASTx.
Best hits with e-value < 10 -4 , and potential recent duplications, defined as aphid genes with evalues <5 orders of magnitude greater than the best hit and with e-value < 10
-4
[3], were reciprocally BLASTed using tblastn against the set of Drosophila Malpighian tubule genes.
Those aphid genes whose top BLAST hit (or a hit with e-values <5 orders of magnitude greater than the best hit) matched back to the original Drosophila gene were considered to be putative orthologs of the respective Drosophila gene. This set of aphid genes was checked against the
RNA-seq experimental data and the genes with the FPKM ≥1 were retained for further analysis.
1.
Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. 2013 TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions . Genome Biol. 14 , R36.
2.
Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL,
Rinn JL, Pachter L. 2012 Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat.Protoc. 7 , 562-578.
3.
Zdobnov EM, von Mering C, Letunic I, Torrents D, Suyama M, Copley RR,
Christophides GK, Thomasova D, Holt RA, Subramanian GM , et al.
2002 Comparative genome and proteome analysis of Anopheles gambiae and Drosophila melanogaster .
Science 298 , 149-159.

Supplementary Table S1 Primers
(a) Barcode for Illumina RNAseq
Organism Tissue Barcode
Drosophila melanogaster whole body CCGTCC
Drosophila melanogaster gut ATGTCA
Acyrthosiphon pisum whole body TGACCA gut AGTTCC Acyrthosiphon pisum
(b) qPCR primers
Target gene
ACYPI005585
Forward primer
CCCCTCATATACGGCCTTG
ACYPI001684
ACYPI009181
ACYPI005230
ACYPI000088
TATAAATCGCGGTGGTCGGG
TACTCTGATAATTGGACACATGCTT
CTCAGTTCCTGAATTATACCATGC
AAGATCGCGTGGTCAGATCC
CGTCCACTTGCATACTCCATT ACYPI009370
Reverse primer
ATTCTTTTGGCGGTGAAGTGC
GACGTCGGAGGAAACGATGA
CAATGTGCTCTTGATCGCCT
TGACAAGAAGGAGACGGCTA
TGAAAATCACAGCGTTGGCG
GGCAATGACTCTCAAAGAGCTG
Product length (bp)
120
90
147
164
103
118

Supplementary Table S3 qRT-PCR validation of RNA-seq data for pea aphid genes. PCR reactions were performed in 20 μl final volume containing 2× iQ SYBR Green Supermix (Bio-rad), 150 nM (final concentration) of each primer and 2 μl cDNA, with reagent-only samples as negative controls. PCR amplification was performed on C1000 Thermal cycler with CFX96 Touch™ Real-
Time PCR Detection System (Bio-rad) under the following thermal profile: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 95 °C for 15 sec, 60°C for 1 min. Dissociation curves confirmed single gene-specific peaks without primer dimerization. For each of two biological replicates, the mean Ct values of technical duplicates were determined and used to obtain log
2
fold-difference: Δ Ct = Ct
(target gene)
− Ct
(reference gene)
, and the mean value is displayed, relative to two normalizing genes (β-tubulin and GAPDH).
Gene name Description Fold-difference (log
2
) between dissected guts and whole body qPCR RNAseq
ACYPI005585 4-aminobutyrate aminotransferase
ACYPI001684 Proton-coupled amino acid transporter
ACYPI009181 Facilitated glucose transporter
ACYPI005230 N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity
ACYPI000088 dicarbonyl/L-xylulose reductase
ACYPI009370 galactose-1-phosphate uridylyltransferase
3.50
1.41
2.45
1.32
1.66
3.33
2.43
1.24
2.43
1.62
2.07
2.77

Supplementary Table S4 Biological processes represented by the Drosophila Malpighan tubule gene set and pea aphid gene orthologs to Drosophila Malpighian tubule genes
Biological process GO term metabolic process GO:0008152
Number of genes (%)
Drosophila
(n=181)
110 (61)
Pea aphid
(n=93)
62 (67) localization cellular process
GO:0051179
GO:0009987
44 (24)
37 (20)
14 (15)
19 (20) biological regulation multicellular organismal process response to stimulus
GO:0065007
GO:0032501
GO:0050896
19 (11)
14 (8)
11 (6)
12 (13)
3 (3)
5 (5)
GO:0032502
GO:0002376
8 (4)
7 (4)
2 (2)
5 (5) developmental process immune system process cellular component organization or biogenesis apoptotic process reproduction biological adhesion
GO:0071840
GO:0006915
GO:0000003
GO:0022610
5 (3)
4 (2)
4 (2)
2 (1)
5 (5)
1 (1)
0
1 (1)

Supplementary Table S5 Pea aphid genes contributing to GO functions that are significantly over-represented in the pea aphid orthologs of Drosophila Malpighian tubule gene set relative to the total annotated gene content of the pea aphid genome
GO Function a PANTHER Code Pea aphid gene name b Gene annotation
1,2 PTHR10233:SF6 ACYPI006069
1,2,4,5 PTHR10277:SF1 ACYPI001872
2 PTHR11014:SF8 ACYPI009740 ,
Methylribose-1-phosphate isomerase
3-hydroxy-3-methylglutaryl-CoA lyaseHMG CoA lyase
Aminoacylase-1 and 1A
ACYPI003420
2 PTHR11772:SF5 ACYPI001577
2,6 PTHR11986:SF6 ACYPI005585
3 PTHR10188:SF6 ACYPI005230
3 PTHR11133:SF11 ACYPI065217
3 PTHR11516:SF1 ACYPI005793
3 PTHR13847:SF161 ACYPI009657
3,5 PTHR22855:SF13
1,4 PTHR10909:SF211
ACYPI009398
ACYPI009436
Asparagine synthetase
GABA transaminase
N(4)-(β-N-acetylglucosaminyl)-L-asparaginase lysosomal
α-aminoadipic semialdehyde synthase
2-oxoisovalerate dehydrogenase (α-subunit)
FOXRED1: FAD-dependent oxidoreductase domaincontaining protein 1
Methylcrotonyl-CoA carboylase (β chain)
Isovaleryl-CoA dehydrogenase

4,5,6 PTHR11941:SF28
4,5 PTHR18866:SF76
ACYPI001467
ACYPI006871
4,5 PTHR23151:SF46 ACYPI006025
Enoyl-CoA hydratase domain-containing protein 3
Methylcrotonoyl-CoA carboxylase (α-subunit)
Lipoamide acyltransferase component of branched-chain αketo acid dehydrogenase complex
5 PTHR12655:SF0 ACYPI002968
1 PTHR10218:SF81 ACYPI004308
1 PTHR11751:SF336 ACYPI001759
1 PTHR24221:SF129 ACYPI003751
Acyl-coenzyme a thioesterase 9
G-protein α11
Kyneurenine-oxoglutarate transaminase
ABC transporter MDR/TAP
6 PTHR10696:SF20 ACYPI071347 Gamma-butyrobetaine dioxygenase a
1, nitrogen compound metabolic process; 2, cellular amino acid biosynthetic process; 3, cellular amino acid catabolic process; 4, coenzyme metabolic process; 5, fatty acid metabolic process; 6, vitamin biosynthetic process. b
Gene indicated in bold are enriched by two fold in the pea aphid gut relative to the whole body (see RNAseq data in Table S3)