Rates of transposition in Escherichia coli
Supplemental Information
Vectorette PCR
In this work we used the vectorette PCR method [1] to estimate the number and location of
6 families of insertion elements (IS) in the genome of Escherichia coli. Briefly, this method
consists in ligating vectorettes
3'
GAGAGGGAAGAGAGCAGGCAAGGAATGGAAGCTGTCTGTCGCAGGAGAGGAAG 5'
||||||||||||
||
|| | | | ||| | |
||||||||||||
5' GACTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC 3'
to the ends of DNA fragments obtained by cutting the genomic DNA with a restriction
enzyme and amplifying the flanking sequences of a known sequence (in this case an IS)
using primers derived from the known sequence and a primer that anneals with the
vectorette. Two independent PCR reactions are thus performed, each with a specific primer
for the known sequence (allowing the amplification of the upstream or the downstream
flanking region) and a primer that anneals with the vectorette. See [1] for a list of the
specific primers for each IS element. The resulting fragments are then separated in an
agarose gel where each band corresponds to an IS copy (see Fig S1 for an example).
Interpretation of vectorette PCR method results
The results obtained for the vectorette PCR (vPCR) method are presented in Table 1 (and
Fig S1). The presence of an extra band, compared with the ancestor, was interpreted as a
copy-and-paste event (+1), the absence of a band as an excision (-1) and the event
involving the simultaneous appearance of a new band together with the absence of a band
present in the ancestral strain was scored as a cut-and-paste event (+1 -1). This last type of
event could also be the result of a copy-and-paste followed by an “excision”. Since in our
experiment the mean number of events per line is below one and more than one event from
the same IS element was detected in a single line, we assume that the probability of
multiple events of this type is negligible.
The estimates of the number of different events were based on the analysis with two
different enzymes. This procedure was designed to increase the power of the analysis, since
four independent reactions are performed to detect the presence of each IS element.
However, some limitations exist in this detection system. The following situations are
potential sources of error in our estimates: a) disruption by a point mutation of a restriction
site (or primer annealing sequence) and b) an event of recombination between two IS
elements. The first situation would be falsely interpreted as a new event of cut-and-paste or
as one excision. The latter can lead to a deletion of one of the elements or to an inversion of
the sequence between the two, which could potentially be scored as two cut-and-paste
events, though no IS element was displaced. We note that these events are less frequent
than transposition though. The probability that a nucleotide is mutated in this mutator strain
is on the order of 6x10-8, assuming a mutation rate of 10-9 per nucleotide per generation for
the wild type [2] and the rearrangements caused by the presence of IS elements are thought
to be at least ten times less frequent that IS elements transposition [3].
Confirmation of transposition / excision events inferred by vPCR
The position of extra IS copies in the ancestral clone, in relation to the reference genome
(NC_000913), was determined by isolating the extra band produced by vPCR from the gel
and sequencing it either with the vectorette primer or the IS-specific primer. This allowed
us to localize one extra copy of IS1 and one of IS5 in our ancestral clone relative to the
reference genome. All MA lines were analyzed in relation to the ancestral clone. To
confirm the excision (or cut) events we designed primers to perform target PCR of the
specific copy. An excision was confirmed when the amplified band was decreased in size
by an amount corresponding to the IS size. If this was not the case the obtained PCR
fragment was further sequenced to determine the cause of miss-inference by vPCR. The
localization of the “paste” events were first determined in the same manner as the extra
copies of the ancestral clone and then we further confirmed the existence of these ISs by
target PCR. In this case a we assume that “paste” event was confirmed whenever the
amplified band was increased in size by the expected amount (dependent on the IS). In the
cases where no increase in size was detected the amplified fragment was sequenced to
determine the cause of miss-inference by vPCR.
Quantification of the precision of the transposition rate estimates
To quantify the precision of the rate estimates, we used the best fit values for each IS
family, and simulated 50 independent lineages. We ran these simulated data through the
procedure described in the Materials and Methods to obtain a new estimate for each of u, w,
and e, and repeated this procedure 50 times. Error bars on Figures 2 (main text) and S2
show the 16th and 84th percentile, equivalent to ± one standard deviation if the data were
normally distributed. This procedure allowed us to assess the degree to which the precision
of our rate estimates is limited by both the finite numbers of observed events and finite
number of lineages.
References
1 Zhong, S. & Dean, A. 2004 Rapid identification and mapping of insertion sequences in
Escherichia coli genomes using vectorette PCR. BMC Microbiology 4, 26.
2 Drake, J. W. 1991 A constant rate of spontaneous mutation in DNA-based microbes.
Proc. Natl. Acad. Sci. U.S.A. 88, 7160–7164.
3 Shen, M. M., Raleigh, E. A. & Kleckner, N. 1987 Physical analysis of Tn10- and IS10promoted transpositions and rearrangements. Genetics 116, 359–369.