Supporting Information Submission to: Functional Ecology The whitefly-associated facultative symbiont Hamiltonella defensa suppresses induced plant defenses in tomato Qi Su1,2, Kerry M. Oliver3, Wen Xie1, Qingjun Wu1, Shaoli Wang1, Youjun Zhang1* 1 Department of Plant Protection, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China 2 College of Plant Protection, Hunan Agricultural University, Changsha, Hunan 410128, China 3 Department of Entomology, University of Georgia, Athens, GA 30602, USA * Corresponding Author: Youjun Zhang (zhangyoujun@caas.cn) One Table: Primers listed in this study Three Figures: 1) Diagnostic PCR for H. defensa 2) PPO activity in whitefly-infested plants 3) PPO activity in saliva-treated plants Table S1. Primers used in this study. Gene name GenBank accession no. LOX U13681 Chi9 Z15140 AOS AF230371 PR-1(P4) AJ011520 Ubiquitin X58253 H. defense 16S rRNA GQ184564 β-actin AF071908 Primer sequence (5’→3’) Fwd: GGAAGGGAAACTGAGCA Rev: TCCCCTGCTGTTATTGG Fwd: TGCTTTTGCTGTCTGCC Rev: GCAGACAGCAAAAGCACAGA Fwd: TCTCTTCCTCTTCCTTCTCTTCACC Rev: CGCCGGGTATAGTCCTGGTAGATA Fwd: ATCTCATTGTTACTCACTTGTC Rev: AACGAGCCCGACCA Fwd: TCGTAAGGAGTGCCCTAATGCTGA Rev: CAATCGCCTCCAGCCTTGTTGTAA Fwd: GCATCGAGTGAGCACAGTT Rev: TATCCTCTCAGACCCGCTAA Fwd: TCTTCCAGCCATCCTTCTTG Rev: CGGTGATTTCCTTCTGCATT Purpose qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qPCR qPCR Figures Supporting Figure 1. Diagnostic PCRs of H. defensa-cured (H−) individuals of B. tabaci MED. Top arrow: whitefly primary endosymbiont P. aleyrodidarum 16S rRNA gene as positive control for the presence of insect DNA. Bottom arrow: H. defensa 16S rRNA gene. A non-cured individual (H+) was included as a positive control. Supporting Figure 2. PPO activity in wild-type Moneymaker and SA-deficient NahG plants infested by whiteflies. PPO activity was measured 48 h after H− or H+ whitefly feeding. Values are means ± SE (n = 6). Different letters indicate significant differences (p < 0.05) by ANOVA and Tukey’s HSD post hoc test. Supporting Figure 3. PPO activity in damaged plants that were treated with saliva from whiteflies. Two hundred μL of diet only or diet fed on by H− (saliva (H−)) or H+ (saliva (H+)) whiteflies was infiltrated into the damaged sites on tomato leaves. PPO activity was measured 48 h after treatment. Values are means ± SE (n = 6). Different letters indicate significant differences (p < 0.05) by ANOVA and Tukey’s HSD post hoc test. Figure S1 Figure S2 Figure S3