fec12405-sup-0001-FigS1-S3-TabS1

advertisement
Supporting Information
Submission to: Functional Ecology
The whitefly-associated facultative symbiont Hamiltonella defensa suppresses induced
plant defenses in tomato
Qi Su1,2, Kerry M. Oliver3, Wen Xie1, Qingjun Wu1, Shaoli Wang1, Youjun Zhang1*
1
Department of Plant Protection, Institute of Vegetables and Flowers, Chinese Academy of
Agricultural Sciences, Beijing 100081, China
2
College of Plant Protection, Hunan Agricultural University, Changsha, Hunan 410128, China
3
Department of Entomology, University of Georgia, Athens, GA 30602, USA
* Corresponding Author: Youjun Zhang ([email protected])
One Table:
Primers listed in this study
Three Figures:
1) Diagnostic PCR for H. defensa
2) PPO activity in whitefly-infested plants
3) PPO activity in saliva-treated plants
Table S1. Primers used in this study.
Gene name
GenBank
accession no.
LOX
U13681
Chi9
Z15140
AOS
AF230371
PR-1(P4)
AJ011520
Ubiquitin
X58253
H. defense
16S rRNA
GQ184564
β-actin
AF071908
Primer sequence (5’→3’)
Fwd: GGAAGGGAAACTGAGCA
Rev: TCCCCTGCTGTTATTGG
Fwd: TGCTTTTGCTGTCTGCC
Rev: GCAGACAGCAAAAGCACAGA
Fwd: TCTCTTCCTCTTCCTTCTCTTCACC
Rev: CGCCGGGTATAGTCCTGGTAGATA
Fwd: ATCTCATTGTTACTCACTTGTC
Rev: AACGAGCCCGACCA
Fwd: TCGTAAGGAGTGCCCTAATGCTGA
Rev: CAATCGCCTCCAGCCTTGTTGTAA
Fwd: GCATCGAGTGAGCACAGTT
Rev: TATCCTCTCAGACCCGCTAA
Fwd: TCTTCCAGCCATCCTTCTTG
Rev: CGGTGATTTCCTTCTGCATT
Purpose
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qRT-PCR
qPCR
qPCR
Figures
Supporting Figure 1. Diagnostic PCRs of H. defensa-cured (H−) individuals of B. tabaci
MED. Top arrow: whitefly primary endosymbiont P. aleyrodidarum 16S rRNA gene as
positive control for the presence of insect DNA. Bottom arrow: H. defensa 16S rRNA gene. A
non-cured individual (H+) was included as a positive control.
Supporting Figure 2. PPO activity in wild-type Moneymaker and SA-deficient NahG
plants infested by whiteflies. PPO activity was measured 48 h after H− or H+ whitefly feeding.
Values are means ± SE (n = 6). Different letters indicate significant differences (p < 0.05) by
ANOVA and Tukey’s HSD post hoc test.
Supporting Figure 3. PPO activity in damaged plants that were treated with saliva from
whiteflies. Two hundred μL of diet only or diet fed on by H− (saliva (H−)) or H+ (saliva (H+))
whiteflies was infiltrated into the damaged sites on tomato leaves. PPO activity was measured
48 h after treatment. Values are means ± SE (n = 6). Different letters indicate significant
differences (p < 0.05) by ANOVA and Tukey’s HSD post hoc test.
Figure S1
Figure S2
Figure S3
Download