Supporting Information for online publication
Appendix S1.
Taxonomic notes on the identification of the Nasutitermes species. The following abbreviations are used to indicate termite collections: AMNH = American Museum of Natural History,
New York; MCZ = Museum of Comparative Zoology, Harvard University, Cambridge; UnB =
University of Brasília.
Nasutitermes acajutlae (Holmgren, 1910)
Soldiers of this species are similar to those of N. nigriceps (Haldeman, 1853) and N. macrocephalus
(Silvestri, 1903). Specimens from French Guiana were identified based on the diagnosis presented by
Thorne et al. (1994) and comparison with non-type specimens (UnB).
Nasutitermes acangussu Bandeira & Fontes, 1979
Compared to the original description and to non-type specimens (UnB). Soldiers of this species are very distinctive and can be recognized easily by their size, shape of head capsule and pilosity.
Nasutitermes callimorphus Mathews, 1977
Compared to the original description and specimens from several localities (UnB), including samples from the type-locality (topotypes).
Nasutitermes corniger (Motschulsky, 1855)
This is a very common neotropical species and was described many times under different names.
Identification was based primarily on the comparison to specimens from several localities of Central and South America (UnB), including samples from the type-locality (topotypes). Soldiers of N. corniger can be distinguished from those of N. ephratae based on their pilosity, especially the short hairs on the surface of the tergites. It is necessary to examine the specimens under high magnification and good illumination. Imagoes of these two species are very different.
Nasutitermes coxipoensis (Holmgren, 1910)
Compared to the original description, to Mathews's (1977) description, to images of syntypes
(AMNH) and to specimens from many different localities (UnB). This is a very common species in
South American savannas and can be recognized by the elongate nasus and the distribution of hairs on thoracic nota and tergites.
Nasutitermes ephratae (Holmgren, 1910)
Compared to the descriptions presented by Holmgren (1910), Emerson (1925), and Mathews (1977)
and to specimens from several localities (UnB). Soldiers of this species are somewhat similar to those of N. corniger and N. coxipoensis , and can be distinguished based on their pilosity, but need to be examined under high magnification and good illumination.
Nasutitermes guayanae (Holmgren, 1910)
See comments under N. similis . Compared to specimens from many different localities (UnB).
Nasutitermes intermedius Banks, 1919
Compared to the Banks's (1919) description, to images of soldiers from the type-colony (MCZ and
AMNH) and to specimens form other localities (UnB). The combination of gut morphology and distribution of hairs on the head capsule are very distinct from any other species of neotropical
Nasutitermes.
Nasutitermes obscurus Snyder & Emerson, 1949
Compared to Holmgren's (1910) description of Eutermes ( Eutermes ) obscurus , to images of syntype soldiers (AMNH) and to specimens from several localities (UnB). Soldiers of this species can be distinguished by their dark color, thick nasus and hairy tergites.

Nasutitermes octopilis Banks, 1918
Compared to the descriptions presented by Banks (1918) and Emerson (1925), to images of syntypes
(AMNH) and to specimens from several localities (UnB). Soldiers of this species have a distinct head shape.
Nasutitermes similis Emerson, 1935
Compared to Emerson's (1935) description and to specimens from several different localities (UnB).
According to Emerson (1935), soldiers of this species are very similar to those of
N. guayanae and cannot be reliably identified based on morphology. Soldiers of N. guayanae are usually darker colored, but due to natural variation and to color change due to preservation in alcohol, this character is unreliable.
Nasutitermes surinamensis (Holmgren, 1910)
Compared to the descriptions presented by Holmgren (1910) and Emerson (1925), to images of
syntypes (AMNH) and to specimens from several different localities (UnB). Soldiers of this species have a distinct head shape and hairy tergites. Gut morphology is also distinct.
Nasutitermes unduliceps Mathews, 1977
Compared to the original description, specimens from several localities (UnB), and images of a paratype soldier from the type-colony.
Nasutitermes wheeleri Emerson, 1925
Compared to Emerson's (1925) original description, to images of a paratype soldier (type colony,
AMNH) and to specimens from different localities (UnB). Soldiers of this species have a distinct pilosity on the head capsule and are easily separated from other neotropical Nasutitermes.
References
Banks N (1918) The termites of Panama and British Guiana. Bulletin of the American Museum of
Natural History 38 , 659–667.
Banks N (1919) Antillean Isoptera. Bulletin of the Museum of Comparative Zoology 26 , 475-489.
Emerson AE (1925) The termites of Kartabo, Bartica District, British Guiana. Zoologica 6 , 291-459.
Emerson AE (1935) Termitophile distribution and quantitative characters as indicators of physiological speciation in British Guiana termites (Isoptera). Annals of the Entomological
Society of America 28 , 369-395.
Holmgren N (1910) Versuch einer Monographie der amerikanische Eutermes - Arten. Jahrbuch der
Hamburgischen Wissenschaftlichen Anstalten 27 , 171-325.
Mathews AGA (1977) Studies on termites from the Mato Grosso State, Brazil Academia Brasileira de
Ciências, Rio de Janeiro, Brazil.
Thorne BL, Haverty MI, Collins MS (1994) Taxonomy and biogeography of Nasutitermes acajutlae and N. nigriceps (Isoptera: Termitidae) in the Caribbean and Central America. Annals of the
Entomological Society of America 87 , 762-770.

Table S1 .
Sequences of primers and PCR profiles used
Genes Primer names
Sequences (5′–3′)
References
Annealing
45°C (1min)
49.5-57.5°C (1min)
45°C (1min)
50°C (1min)
COII Modified A-tLeu CAGATAAGTGCATTGGATTT
B-tLys GTTTAAGAGACCAGTACTTG
COI LCO1490F
HCO2198R
GGTCAACAAATCATAAAGATATTGG
TAAACTTCAGGGTGACCAAAAAATCA
(Miura et al.
(Folmer
(Folmer
2000)
(Liu & Beckenbach 1992; Simon
et al.
et al.
1994)
1994)
et al.
1994)
16S
ITS2
16S-F1
16S-R4
ITS2F
ITS2Rnas
TTACGCTGTTATCCCTAA
TCTGGTTTTTCAAGAAATGA
TGTGAACTGCAGGACACAT
GCTTAAATTCAGMGGGTAGTC
(Kambhampati & Smith 1995)
(Miura et al.
2000)
(Jenkins et al.
2001) modified from Jenkins et al. 2001 for this study
Genes Initial denaturation Denaturation
COII 94°C (3min)
COI
94°C (2min)
16S
94°C (3min)
ITS2
96°C (5min)
94°C (30s)
94°C (1min)
94°C (30s)
96°C (30s)
Extension
72°C (3min)
72°C (1min15s)
72°C (3min)
72°C (1min30s)
Final extension
72°C (10min)
72°C (7min)
72°C (10min)
72°C (5min)
References
Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular
Marine Biology and Biotechnology 3 , 294-299.
Jenkins TM, Dean RE, Verkerk R, Forschler BT (2001) Phylogenetic analyses of two mitochondrial genes and one nuclear intron region illuminate European subterranean termite (Isoptera:
Rhinotermitidae) gene flow, taxonomy, and introduction dynamics. Molecular Phylogenetics and Evolution 20 , 286-293.
Kambhampati S, Smith PT (1995) PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Molecular Biology 4 , 233-236.
Liu H, Beckenbach AT (1992) Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Molecular Phylogenetics and Evolution 1 , 41-52.
Miura T, Roisin Y, Matsumoto T (2000) Molecular phylogeny and biogeography of the nasute termite genus Nasutitermes (Isoptera: Termitidae) in the Pacific tropics. Molecular Phylogenetics and
Evolution 17 , 1-10.
Simon C, Frati F, Beckenbach A , et al.
(1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87 , 651-701.
Cycles
35
40
35
45

Table S2.
Mean corrected p-distances within each PSH (intra-cluster p-distance) for the COII gene.
SE: standard error, N: sample size, n.a.: not available/not calculable
PSH
PSH 1
PSH 2a
PSH 2b
PSH 3
PSH 4
PSH 5
PSH 6
PSH 7
PSH 8
PSH 9
PSH 10
PSH 11
PSH 12
PSH 13
PSH 14
PSH 15
N p SE
8 0.0016 0.0007
3 0.0010 0.0010
1 n.a. n.a.
11 0.0027 0.0010
1 n.a. n.a.
1 n.a. n.a.
10 0.0015 0.0006
1 n.a. n.a.
8 0.0008 0.0007
3 0.0000 0.0000
1 n.a. n.a.
2 0.0016 0.0016
6 0.0014 0.0008
14 0.0004 0.0003
3 0.0005 0.0005
6 0.0030 0.0010

Table S3.
Pairwise corrected p-distances between PSHs (inter-cluster p-distance) for the COII gene
(below diagonal) and Standard Errors (above diagonal).
PSH 1 PSH 2a PSH 2b PSH 3 PSH 4 PSH 5 PSH 6 PSH 7 PSH 8 PSH 9 PSH 10 PSH 11 PSH 12 PSH 13 PSH 14 PSH 15
PSH 1
PSH 2a 0.048
0.008 0.007 0.007 0.010 0.012 0.010 0.011 0.012 0.012 0.010 0.012 0.013 0.012 0.016 0.015
0.004 0.006 0.011 0.012 0.013 0.012 0.012 0.012 0.012 0.012 0.014 0.013 0.016 0.015
PSH 2b 0.040 0.013
PSH 3 0.036 0.023 0.018
0.005 0.010 0.011 0.011 0.011 0.011 0.012 0.012 0.012 0.014 0.013 0.016 0.015
0.010 0.011 0.011 0.011 0.011 0.012 0.011 0.011 0.014 0.013 0.016 0.015
PSH 4 0.066 0.074 0.070 0.064
PSH 5 0.076 0.075 0.070 0.066 0.080
0.012 0.012 0.012 0.012 0.013 0.012 0.013 0.013 0.012 0.016 0.014
0.013 0.013 0.012 0.012 0.013 0.013 0.015 0.012 0.016 0.015
PSH 6 0.073 0.093 0.082 0.080 0.087 0.087
PSH 7 0.074 0.091 0.082 0.080 0.087 0.089 0.024
0.006 0.009 0.008 0.008 0.009 0.012 0.012 0.016 0.014
0.009 0.008 0.008 0.010 0.011 0.012 0.017 0.014
PSH 8 0.085 0.083 0.080 0.079 0.082 0.081 0.053 0.058
PSH 9 0.080 0.088 0.085 0.085 0.092 0.083 0.050 0.047 0.042
0.007 0.008 0.010 0.013 0.011 0.014 0.016
0.007 0.009 0.012 0.012 0.016 0.015
PSH 10 0.068 0.082 0.080 0.078 0.086 0.083 0.047 0.050 0.048 0.032
PSH 11 0.084 0.090 0.085 0.082 0.090 0.088 0.051 0.062 0.057 0.047 0.054
0.009 0.012 0.011 0.016 0.014
0.012 0.013 0.015 0.015
PSH 12 0.098 0.108 0.107 0.108 0.095 0.105 0.087 0.083 0.103 0.092 0.089 0.091
PSH 13 0.096 0.096 0.102 0.100 0.091 0.081 0.084 0.089 0.083 0.084 0.079 0.092 0.089
0.013 0.016 0.014
0.014 0.013
PSH 14 0.131 0.135 0.131 0.131 0.126 0.124 0.118 0.132 0.105 0.126 0.129 0.103 0.127 0.098 0.016
PSH 15 0.123 0.127 0.129 0.127 0.113 0.112 0.115 0.115 0.132 0.117 0.117 0.118 0.106 0.100 0.123

Fig. S1.
Map of French Guiana, showing the 16 geographic sites of termite sampling. Figure inset, localization of French Guiana within South America.

Fig. S2. Median joining network showing relationships between reconstructed ITS2 haplotypes of
Nasutitermes complete dataset (N=75x2). Each PSH is represented with a different color; pie diagrams showing shared reconstructed alleles between PSHs.