DNA Transcription and Translation
DNA is the genetic code of life. It stores the directions necessary for the cell to make proteins. However, this
information is written in a language our cells cannot understand and locked tightly in the nucleus where
organelles cannot reach it. To make this information accessible to our cells, the DNA must be opened and
written in a language cells can understand. These processes are called transcription and translation. This is the
central dogma of biology:
DNA  RNA  Protein
Transcription (DNA  RNA):
________________________ is the process of copying a short segment of DNA into _________________
using the enzyme called _________________________. We know this is an enzyme because it ends in the
letters ______________. This process occurs in the ____________.
____________ is a ________________________ nucleic acid with a sugar-phosphate backbone. Unlike DNA,
RNA uses ______________________ as its sugar (instead of deoxyribose) and the bases adenine, guanine,
cytosine and __________________. Note – thymine is unique to DNA. The monomers of RNA are called
____________________. There are three types of RNA:
1. ____________________________
2. ____________________________
3. ____________________________
The cellular process transcription has three steps:
1. _____________________________
2. _____________________________
3. _____________________________
In the first step the enzyme __________________________ binds to the antisense (3’ to 5’) strand, also called
the template strand, of DNA at a location called the _____________________________. This is called the
promoter sequence because it promotes replication. RNA polymerase begins to ___________________ DNA so
the genetic code (also called ____________________) are accessible.
Why is it called the antisense strand? Is there a sense strand too?
In the second step __________________________ (mRNA) is built. This is the transcript that will take the
instructions outside of the cell to the ________________ that build proteins. RNA polymerase builds mRNA by
matching _____________________ to those on the antisense strand of DNA.
In DNA A pairs with T, but there is no T in RNA. Which base in RNA pairs with the A from DNA?
In the third step RNA polymerase stops building mRNA when it reaches the
________________ ______________________. The completed mRNA transcript
detaches from the DNA, and the double helix closes tightly again. The mRNA
transcript leaves the nucleus through ________________________ and goes to the
___________________ where it will be translated into proteins.
How is mRNA like a transcript or a text message? Explain in your own words.
How are DNA and RNA similar and different?
DNA
Sugar
Bases
Number of
Strands
Function
RNA
Translation (RNA  Protein):
__________________ is the process of translating ______________ into ________________. This process
takes place in the ________________ and uses the organelles called ________________. Ribosomes are made
of _________ and have _______ subunits called the
small subunit and the _____________ subunit.
The cellular process translation has three steps:
1. _____________________________
2. _____________________________
3. _____________________________
When the newly made mRNA enters the cytoplasm it is
grabbed by a ___________________. This is the
initiation step of translation. The ribosome scans the
mRNA for the _______________________ with the
letters ________. mRNA is always read _______
letters at a time. These letters are called
__________________ because they code for specific
______________________________.
In step two the ribosome will continue to build the protein by matching ______________ with the correct
______________________ to the codons on the mRNA template. The tRNA brings with it an
___________________ which bind together to make a ________________________ chain which is also called
a protein.
The ribosome continues to read the mRNA building a long
chain of amino acids. In the third step, the ribosome encounters
a _____________________________ and detaches from the
mRNA releasing the newly made protein into the
_______________________. The protein will then go to
another location in the cell where it will be modified before it
can serve its purpose.
Proteins are also called polypeptides because they form a
chemical bond between amino acids called a
_________________________.
What organelles are involved with protein building and modification?
Use this interactive lesson from PBS media to practice transcription and translation
http://www.pbslearningmedia.org/resource/lsps07.sci.life.stru.celltrans/cell-transcription-and-translation/
Transcription and Translation Practice - Answer the questions below
Where in the cell does transcription take place?
Where in the cell does translation take place?
What does a codon do?
What is in charge of bringing the amino acids to the ribosomes? How does this work?
How are amino acids and proteins related?
Translating proteins: Use your codon chart to translate codons into amino acids.
UAG:
AAU:
GCC:
CGGUAC:
Transcribing and Translating:
DNA: TAAGCTACCTTCGCATGGCATGCATC
RNA:
Find the start codon. Now, read the mRNA one codon at a time left to right, circling the codons ad you go. Use
your codon chart to write the amino acid chain below.
Amino Acid Chain:
DNA: ATTACCATGTGGACAACATCCT
RNA:
Amino Acid Chain: