Inquiry Inquiries:
Differentiation & Scientific Practices
Catherine Cho, Gregory Dorsey, Mary Duff, Conor Ganon, Amelia Nystrom,
Davis Tran, & Nathan Weiss
Graduate student advisor: Lindsay Wheeler
Faculty advisor: Jennifer Maeng
University of Virginia, Curry School of Education
Resources from the 2014 VAST Presentation
To use this document, click on the link in the list below to be taken to the first page of the
desired resource. Links within a resource will take you to student handouts or data pages.
1. Predicting Changes to Oceanic and Atmospheric Systems in Response to Changing
Carbon Dioxide Concentrations
2. Energy Transformations
3. Where Do I Belong? Classifying Your Species Using Evidence
4. Resources for Inquiry, Scientific Practices, and Differentiated Instruction
Predicting Changes to Oceanic and Atmospheric Systems in Response to
Changing Carbon Dioxide Concentrations
Activity Overview:
Essential Question: How will global climate change affect atmospheric and oceanic systems?
Students will be introduced to the trend of increasing global CO2 concentrations. Then they will
investigate the effects of increased CO2 in various areas (pH of water, greenhouse effect, and ice
melt). Afterward groups of students will have the option to choose between analyzing data from
the atmosphere or the oceans in order to make an argument stating how they predict these
systems could change in the future. Students will be evaluated based on their arguments.
Differentiated Scientific Practices in the Activity:
Analyzing and interpreting data
Engaging in argument from evidence
Differentiation Strategy:
Differentiation by interest: Students will choose between analyzing/interpreting atmospheric or
oceanic responses to increasing CO2 concentration during the extend section of the activity.
Differentiation by learning preference: Students will choose how to present the argument they
come up with based on the evidence they choose (example: types of graphics used to make
argument) during the evaluate section of the activity.
Standards/Benchmarks:
SOLsES.10 The student will investigate and understand that oceans are complex, interactive physical,
chemical, and biological systems and are subject to
long- and short-term variations. Key concepts include
a) physical and chemical changes related to tides, waves, currents, sea level and ice cap
variations, upwelling, and salinity variations;
b) importance of environmental and geologic implications;
c) systems interactions;
ES.11 The student will investigate and understand the origin and evolution of the
atmosphere and the interrelationship of geologic processes, biologic processes, and
human activities on its composition and dynamics. Key concepts include
d) potential changes to the atmosphere and climate due to human, biologic, and
geologic activity.
ES.12 The student will investigate and understand that energy transfer between the sun and Earth
and its atmosphere drives weather and climate on
Earth. Key concepts include
a) observation and collection of weather data;
b) prediction of weather patterns;
d) weather phenomena and the factors that affect climate including radiation,
conduction, and convection.
NGSSHS-ESS3-5. Analyze geoscience data and the results from global climate models to make an
evidence-based forecast of the current rate of global or regional climate change and associated
future impacts to Earth systems.
NGSS Practice 4- Analyzing and interpreting data
NGSS Practice 7- Engaging in an argument from evidence
Materials
worksheets
clear cups
straws
pH indicator (bromothymol blue)
3 clear buckets with a shelf/prop for ice (labeled 1a, 2a, and 3a)
3 buckets with no shelf (labeled 1b, 2b, and 3b)
water
climate/ocean data charts
model data
photographic data
http://geology.com/sea-level-rise/
Procedure
Introduction (Engage): (10 min)
Introduce the concept that carbon dioxide concentration in the atmosphere is increasing
by showing video clip from the movie The Day After Tomorrow
(https://www.youtube.com/watch?v=w_1VnGp8Lls)
Begin discussion Questions:
Has anyone ever seen this movie? EA: Yes, it’s The Day After Tomorrow!
Yeah, this clip is from near the middle of the film. What happens in this movie? EA:
Climate change causes the planet to get really cold and experience weird whether.
Basically, a large area of Earth freezes over. Kind of like an ice age.
That’s a good summary of the movie. Why does the climate change, though? EA: I think
it’s because of people. Isn’t it global warming or something?
Right! They mention how areas of the Earth warm up and change the oceans and the
atmosphere. Do you know one of the major reasons for why the Earth might experience
these changes? EA: Not sure/Certain gases/Carbon dioxide?
A large part of it has to do with the gases that humans are putting into the atmosphere.
One of the most important gases related to such changes is carbon dioxide. EA: Why?
Because humans are emitting carbon dioxide into the atmosphere from industry,
automobiles and other sources. Carbon dioxide concentrations in the atmosphere have
been increasing since the late 1800s (show graph of carbon dioxide concentration data
from 1800s until present). We are going to explore how carbon dioxide can affect the
planet.
Activity (Explore, Explain, Extend): (95 min)
Explore: (65 min) In groups of 4 students explore various changes that take place in the
atmosphere and oceans due to CO2 concentration changes at during three different
activities where they will need to make observations and answer questions. (See activity
sheets below.)
During Activity 1 (45 min) students explore the changes that carbon dioxide makes to the
global temperature by observing the greenhouse effect through a PhET simulation.
During Activity 2 (10 min) students explore the effect that carbon dioxide concentration
in water changes the pH by blowing bubbles into water with a pH indicator and watching
it become more acidic.
During Activity 3 (10 min) students explore the changes that melting glaciers have on sea
level by watching a demo set up in the classroom of melting ice from land and how it
runs off into the ocean and how that is different from ice caps in the water melting.
Explain: (15 min) As a whole class, discuss the observations made at each of the
different station activities and how the interactions that carbon dioxide and temperature
change have with these systems manifest themselves on a larger scale. Questions:
What effect does carbon dioxide have on heat in the atmosphere? EA: It traps it in
How does an increase in carbon dioxide effect global temperatures? EA: it increases them
If global temperatures are increasing what will happen to the ice on the earth? EA: it will
melt
Where does the water of the ice melt go? EA: to the ocean
If the melting ice originated from land glaciers, how does this effect sea level? EA: it
rises
What happens when carbon dioxide is dissolved in water? EA: lowers pH
If carbon dioxide from your breath can dissolve in water, how might the carbon dioxide
from the atmosphere interact with large bodies of water on earth? EA: it can dissolve in
them and lower the pH
Extend: (15 min) Students explore these system interactions on a larger
scale through the analysis and interpretation of data. Students choose a system to look at
either acidification of the oceans, sea level rise due to glacial melt, or changes in
atmospheric and global temperature. Students are given graphs showing data that
represents the change in their system over time (see attached). They analyze and interpret
the graphs and make an argument based on evidence about the future of their system.
Debrief (Evaluate): (30 min- will vary depending on class size) Students choose a means to
present their argument and are assessed on their performance using the rubric (provided).
Rewatch video clip from Engage and have s. critique information in video based on what they
learned.
Modifications
 Instead of implementing station-based work during the explore phase, the teacher can
perform whole-class demonstrations and guide students through the concepts.
 Varying levels of scaffolding can be used during station/demonstration portions of the
lesson (e.g. Guiding students through the simulations or activities, whole class, small
groups, individual)
 The extend and evaluate phases have the potential to be carried out as individual or
small-group work.
Assessment Strategies
A rubric (see below) will be used to evaluate student groups’ arguments.
Source:
Developed by Nathan Weiss and Amelia Nystrom, 2014, University of Virginia, Curry School of
Education
Student Handouts for Station Activities
Activity 1: Greenhouse Gases Simulation
(http://phet.colorado.edu/en/simulation/greenhouse)
→Background Information: Earth’s atmosphere is made up of a variety of gases these include
nitrogen, oxygen, argon, carbon dioxide, water vapor.
→ Click on the Photon Absorption tab at the top of the screen.
→ On the right hand side of the screen select the CO2 molecule so that it appears in the middle of
the screen.
→ Under the lamp on the left hand side of the screen select the infrared photon to be emitted
→ Move the slide on the lamp towards the red side so that it emits the infrared photons
1.
What happens when the infrared photons are aimed at the carbon dioxide molecule?
→ Next under the lamp on the left hand side of the screen select the visible photons
2.
What happens when the visible photons are aimed at the carbon dioxide molecule?
→ Next click on the Glass Layers tab at the top of the screen. Make sure the thermometer box on
the right hand side of the screen is checked.
3.
Where are the visible photons coming from?
4.
When do the infrared photons appear?
5.
Where do the infrared photons go after they appear?
→ Next add a glass pane to the atmosphere and notice what happens to some of the infrared photons
6.
What happens to the infrared photons when you add a glass pane to the atmosphere?
7.
What happens to the temperature when you add a glass pane to the atmosphere? Write the
temperature below once it stabilizes.
→ Next add the other two glass panes to the atmosphere
8.
What happens to the amount of infrared photons near the ground as the number of glass
panes is increased?
9.
What happens to the amount of infrared photons going out into space as the number of
glass panes is increased?
10.
How has temperature changed with an increase in the amount of glass panes? Write the
temperature below.
11.
What is the relationship between the temperature and the amount of infrared photons
staying in the atmosphere?
12.
Based on this relationship what do you think infrared photons are?
→ Prediction
13.
Based on your observations of what carbon dioxide does to infrared photons and what
glass panes do to infrared photons, how do you think the amount of infrared photons in
the atmosphere would change if you increased the amount of carbon dioxide in the
atmosphere and how would this affect the temperature?
→ Next click on the greenhouse gases tab at the top of the screen
14.
Fill out the table below by clicking on the different scenarios on the right hand side of the
page and gathering information from the “Ice age”, “1750”, and “today”.
CO2 in the
atmosphere
Global
Temp (͒F)
Relative amount of infrared photons in the
atmosphere (low, med, high)
Ice Age
1750
Today
15.
How did your prediction of changes in temperature with increased carbon dioxide in the
atmosphere compare to the results in your data table?
16.
How does temperature change with increases in atmospheric carbon dioxide? Why
do you think this happens?
Activity 2: Carbon Dioxide and water pH
→ Background information: When you breathe in, your body takes in oxygen, this oxygen is
converted into carbon dioxide through a process called cellular respiration, and when you breathe
out the carbon dioxide is released from your lungs.
→ Using a straw, you are going to blow carbon dioxide from your lungs, into a beaker of water
containing a pH indicator called bromothymol blue. The pH indicator turns yellow in acidic
solutions and blue in neutral and basic solutions.
→ Before you begin make an observation about the color of the water with the pH indicator
1.
What color is the water and bromothymol blue to begin with? What does this indicate
about the pH of the solution?
→ Next blow carbon dioxide into the solution using the straw until you notice a distinct change
in the solution.
2.
What happened to the color of the solution? What does this indicate about the pH of the
solution?
3.
Based on your observations, when carbon dioxide dissolves in water, what happens to the
pH of the water?
4.
How would you expect the pH of bodies of water on earth to change if carbon dioxide
was dissolved in them?
Activity 3: Glacier melt and sea level change
→ Background Information: As matter gains heat it changes phases from a solid to a liquid and
eventually to a gas. Many land masses on the globe are covered with glaciers, which are large
areas of compacted ice, water in its solid phase.
→ The six containers you are looking at all began with the same amount of ice on the shelf or
floating in the water, and the same amount of water in the bucket, which is indicated by a black
line. The first two containers (one with a shelf and one without) was just set out, the second two
containers (one with a shelf and one without) was set out 30 min ago, and the third two containers
(one with a shelf and one without) an hour ago.
1.
What do you notice about the relative amount of ice on the shelf of buckets 1a, 2a, and 3a?
(which one has the most, which one has the least?)
2.
What do you notice about the relative water levels in buckets 1a, 2a, and 3a?
3.
What do you notice about the relative water levels in buckets 1b, 2b, and 2c?
4.
What has happened to the ice over time and why? Where has the ice gone?
5.
If the ice on the shelf of the bucket represents land glaciers, and the water in the bucket
represents sea level, how would you expect sea levels to change with an increase in global
temperatures?
Data Analysis Activity
Now that we have explored the changes that carbon dioxide makes to different earth systems, your
mission is to use data collected from these systems to predict potential changes that might take place
in the future. You will have a choice of looking at temperature data, ocean pH data, or sea level
rise/glacial ice melt data that shows how these numbers have changed over time up until now. You
will be analyzing and interpreting the data and using your knowledge to make an argument about the
future of the system you are looking at.
1.
Which system are you going to look at?
2.
What background information from this unit do you have related to how carbon dioxide in
the atmosphere impacts the system you are going to look at?
3.
Looking at the data from your selected system, what trends do you notice regarding
how it has changed over time?
4.
What do these trends indicate is occurring within this system on a larger global scale
from the past up until now?
5.
Make an argument to predict how your system might change in the future. Use
your background knowledge about the science of the system, as well as the data you’ve been
looking at to support your thinking about what will happen in the years to come.
Prediction- What is going
to happen to your system
in the future?
Supporting data- How
does the data you’ve
analyzed help you make
this prediction?
Scientific KnowledgeWhat scientific
knowledge helps you
understand these data
trends and what is
happening to cause them?
Strengths and
Weaknesses- How clear
is the data? What are other
possible explanations for
what is going on?
Making and Presenting an Argument
Using the data you’ve interpreted, you will be presenting an evidence-based argument about your
topic. How you present your argument is up to you, you can do so in the form of a global map, a
narrative writing, a video, a mathematical model or any other means that is approved of first. Think
about the argument you are making and what means of presenting it makes most sense to you. Your
argument should include the scientific knowledge you have on the issue, the data analysis that led to
your conclusions, what about this data supports your argument, and what the strengths and
weaknesses of your argument are. You will be evaluate on your argument using the rubric below:
3
Meets all
expectations
2
Meets some
expectations but
requires further
synthesis of
background
information
Data analysis/
interpretation- Patterns and
trends in data are accurately
recognized and noted in the
argument. Analysis is
extended in a logical way to
support the prediction.
Prediction- Argument
includes a description of the
patterns that will emerge in
the future for the system
being analyzed.
Meets all
expectations
Meets some
expectations but
requires further
analysis and
interpretation of
data
Meets all
expectations
Presentation- Argument is
delivered in a clear,
concise, and organized
manner. Strengths and
weaknesses of the
argument are included.
Meets all
expectations
Meets some
expectations but
requires further
explanation or
description of
prediction.
Meets some
expectations but
strengths and
weaknesses not
fully addressed.
Background informationArgument includes scientific
concepts related to the
system being analyzed.
Scientific concepts are used
to explain the argument.
1
Meets few
expectations, and
requires further
inclusion or
synthesis of
background
information
Meets few
expectations, and
requires further
inclusion or
analysis of data
trends
0
Element
not
present
Meets few
expectations, and
requires further
development of the
prediction.
Element
not
present
Meets few
expectations, and
requires further
organization and
clarity. Strengths
and weaknesses are
not fully addressed
or may not be
present.
Element
not
present
Element
not
present
Global CO2 and Temperature Data
Global CO2 and pH Data
Glacier Melt and Sea Level Rise
Energy Transformations
Activity Overview:
In this activity, students investigate the flow of energy through various natural models. The
students investigate how energy is generated, transferred, or removed within their selected
model. Students choose to explore a physical, chemical, or biological model related to energy
transfer.
Differentiated Scientific Practices in this Activity:
Asking Questions: When students ask “What is energy?”, “Where does it come from?”,
or “Where does it go?” there are many possible answers. Looking at plant models,
physical activity, and chemical changes are all different media for asking that question.
Developing and Using Models: Students are able to use different models to answer their
question. Based on their interests, they can choose a physical model, a chemical model,
or a biological model.
Communicating Information: Students will gain practice taking a variety of data and
converting their findings into a common language that can be discussed with other
investigators. In this case, students will take data from the various models discussed
above and convert it into calories in order to compare the amounts of energy involved in
each model.
Differentiation Strategy:
Differentiating by Interest: Students are given a choice of activities which allow them
to learn about energy in the context of biology, chemistry, or physics.
Standards/Benchmarks
SOL LS.5 - The student will investigate and understand the basic physical and chemical
processes of photosynthesis and its importance to plant and animal life. Key concepts
include
a) energy transfer between sunlight and chlorophyll
NGSS MS-LS1-6. Construct a scientific explanation based on evidence for the role of
photosynthesis in the cycling of matter and flow of energy into and out of organisms.
SOLs: PS.6 The student will investigate and understand forms of energy and how energy
is transferred and transformed. Key concepts include
a) potential and kinetic energy; and
b) mechanical, chemical, electrical, thermal, radiant and nuclear energy.
Materials (For each group of 3-4 students)
For Physics
Meter Stick
Stopwatch
Calculator
For Biology
Beaker, 600 cm3, 1
Yardstick or ruler
Elodea or other oxygenating pond plant
Scissors
Forceps
Electric lamp
Clamp stand with boss and clamp
Stopwatch
Heated Water and Ice Water
Thermometer
For Chemistry
Beaker, 50mL
Temperature Probe
Matches
Food- cheerios, cheetoes, nut (check for
allergies!), marshmallow
Tongs
Electric Balance
Paperclip hooked into a rubber stopper
Procedure
Introduction: 5 min
● Teacher asks students what their bodies use as energy during sports activities. (EA: Food)
Teacher then asks students what nutrition facts on the back of food packages tell us about
the energy in food? (EA: measured in Cal, how much energy is in different types of food)
What does our body use energy for? (EA: motion, breathing, digestion) Teacher asks
where the energy in food comes from? (EA: sugars, fats, plants, animals, the sun)
● Teacher tells s. that they will be able to choose one of these pathways for energy flow for
more exploration. Students choose groups based on interest.
○ Biology (photosynthesis): Sun’s energy and minerals converted into sugar
○ Chemistry (calorimetry): Chemical energy from food converted into heat
○ Physics (work): Food energy converted to doing work.
● Within these interest groups, students should work in small groups of 3-4 students:
Activity: ~15-20 minutes for each activity
Option A: Physics Sports Activity:
a. Students discuss and write down all the different things that they do for sports.
b. Students should understand, before completing the activity, that if it involves a change in
speed it is a kinetic energy. If it involves a change in height, it is gravitational potential
energy. Students then label their previously written activities in part a KE or PE
depending on rather they have a change in height or speed.
c. Each group then picks two activities from a preapproved list to measure a change in
speed or a change in height for. (Modification: Students may also ask if the teacher can
approve one of their activities listed earlier to do.)
d. Students then use PE= m * g * h or KE = ½ * m * v^2 to calculate the amount of energy
in joules for each of their two chosen sport activities. Students then divide that number by
4184 J to get how many Calories they burn. Note that for mass 1 pound = .45 kg and for
speed 1 mile/hour = .45 m/s (Modification: Depending on the students’ level, the teacher
may do this conversion with them as a class.)
e. If there is extra time, students can come up with another activity to measure the energy of
with the teacher’s permission.
See: Physics: Energy in Sports (Worksheet)
Option B: Biology Pondweed Activity
● The teacher should set up stations (3-4) as shown in the diagram above prior to class.
These should be set up in a space in the room where the lights can be turned off or
dimmed.
● Students look for a stream of bubbles coming from the cut end of the pondweed.
● Students count the number of bubbles produced in 1 minute. Repeat twice and
calculate a mean bubble count – number of bubbles per minute. This is the mean rate
of bubble production.
● Students now change the temperature of the pondweed water by moving the Elodea
sample either too hot or cold water.
● Students let the system settle for 2 minutes and then count the number of bubbles
produced in one minute and record this (See attached student handout).
● Repeat the count and calculate the mean rate of bubble production as before.
Option C: Chemistry: Food Calorimetry Lab
a. Students will work in groups of 3-4 and each group should be able to to test 2 different
food--which can be bread, cheese, crackers, pasta, etc.
b. First, students measure the mass of their piece of food on an electric balance. Students
record this information onto their handout.
c. The calorimeter is set-up by using a 50 mL beaker filled with 10 mL of water on a ring
stand with a wire gauze on a ring stand and this should be set up so that it stands over a
Bunsen burner.
d. The temperature probe is used to measure the temperature. Students record the initial
temperature of the water prior to burning the food with a temperature probe. (See
attached student handout.)
e. Students hook the food to the end of a bent paperclip that is hooked into a rubber stopper.
f. Students place the beaker of 10 mL of water on a ring stand about 1 cm from the food on
the stopper/paper clip set up and light the food on fire using a match.
g. After the food is burned, students record the temperature of the water with the
temperature probe.
h. Students repeat these procedures using one other piece of food.
i. Students find the water’s temperature change before and after burning each food sample.
Debrief: 10-15 min
In their “interest” groups, have students respond, on their student handouts to the following
questions.
1. Where did your energy come from and what happened to it? (EA: Biology: The energy
came from the sunlight and it got turned into oxygen and food for the plant. Chemistry:
The energy came from the food and it got turned into heat Physics: The energy came
from our body, or food, and got used for playing a sport.)
2. How does this amount of energy compare to an 8oz. steak (about 450 Calories) and is
that what you expected? (EA: Biology: It is a whole lot less. We only counted a few
dozen bubbles but it takes one million just to make a single Calorie. I did expect it to be a
lot less because the plant was very small compared to a steak. Chemistry: It was a lot less
(Expected ranges .25 to .50 Calories). We thought it would be because our food was
small compared to a steak. Physics: It was a lot less (Expected ranges.05 to .50 Calories).
I thought it would be because it takes a long time to burn Calories.)
Have students report their findings in a whole class discussion. Then, students answer the
following questions:
1. What did the biology group do and how much energy was involved? (EA: The biology
group shined a lamp on an Elodea sample and measured the number of oxygen bubbles
that each plant produced over the course of a minute. The students did this for two
different temperatures of water. They then used a provided conversion between number
of oxygen bubbles and Calories produced and used this to estimate how much energy the
plant produced for itself in that minute. The answer is a very small amount, only in the
1/10,000 Calorie range.)
2. What did the chemistry group do and how much energy was used? (EA: The chemistry
group burned different pieces of food using a calorimeter. Students measured the change
in temperature of the water and use the mass of the food, change in temperature, and the
specific heat of water. Students will then have to convert the energy calculated from
Joules to calories. How much energy was used will vary depending on the group and the
food.)
3. What did the physics group do and how much energy was used? (EA: The physics group
measured a change in height or speed for doing different sports. They used that to
calculate how much energy was used to do it in Joules. They used potential and kinetic
energy formulas for this. They then converted Joules to Calories. (The amount of energy
used will vary depending on shared activities.)
4. How does the amount of energy your group found compare to the amounts the other
groups found? (EA: The biology group had the least because it takes a lot of bubbles to
make a Calorie. The chemistry and physics groups had about about the same amount of
Calories.)
After this whole class discussion students should be able to answer the final question on their
handout: How do the energies from each model (biological, chemical, physical) compare?
(Draw a picture or write the relationship) (EA: In the biology group, they saw how energy is
entering a system and being produced by a living thing. The chemistry group shows how
chemical energy found in food is used by the body and expended as heat or thermal energy. The
physics group used energy in the body to play a sport or do something. The energy the body used
to do the activity came from food.)
Modifications
For the Physics activity:
--Hall modification: The teacher may choose to allow students to do their change in speed
activity measurements in the hall but they have to be approved first.
-- This activity is best placed after the concept of center of mass has been introduced. If not the
students should be shown a demonstration for an activity like a sit up where the change in height
measured for potential energy is from the center of the torso.
--Collecting data could be done on a spreadsheet with calculation cells for groups which do not
know the math to do the calculations on their own.
For the Biology activity:
-- Students could be asked in a pre-lab session the previous lesson to volunteer their own factors
that they want to test. With teacher approval, they can bring in their own materials to test these
more unique ideas.
-- Different colored lamps could be used to try and students can decide what color light is needed
for photosynthesis.
-- For a more intense or mathematical setting, students can be required to come up with a
quantitative measure of energy production. Suggestion: have students calculate heat change in
beaker of water vs. heat change in beaker with pondweed
For the Chemistry activity:
--The lab can be set up to be have an added objective where students try to investigate what type
of food (lipid, carbohydrate, proteins) has the higher energy content.
--If students want to bring in other foods to test, they can with prior permission. (Check for food
allergies before burning foods in class!)
--Have students input their data into a spreadsheet that converts joules to calories if they have
not learned dimensional analysis. q=mCDT
--If temperature probes are not available, thermometers can be use instead.
Assessment Strategies
Structured Inquiry: If this is done as a structured inquiry activity, then a lab worksheet with
preconstructed data tables set to a specific procedure could be utilized, followed by calorie
calculations and application questions. Perhaps students could be required to write up a formal
lab report as well.
Guided Inquiry: If this is done as a guided or open inquiry activity, then assessment could
measure the students’ ability to set up their own procedure in response to a question (and in the
case of open inquiry their ability to generate a testable hypothesis) in addition to the lab report
activities mentioned above.
Source:
Physics Source:
Developed by Gregory Dorsey, 2014, University of Virginia, Curry School of Education
Biology Source:
http://www.nuffieldfoundation.org/practical-biology/investigating-factors-affecting-ratephotosynthesis
Chemistry Sources:
http://www.lopezlink.com/Labs/Calorimetry%20Lab/calorimetry%20lab.htm
http://www.mychandlerschools.org/cms/lib6/AZ01001175/Centricity/Domain/626/Food%20Lab
%20Sample%20DH.pdf
Physics, Energy in Sports
Playing outside is fun! Many of us also like to play sports.
Background questions: There are two main types of sport activities. Activities that change
something’s height or activities that change speed.
What are sports and activities you like that change your or something’s height or speed?
Sports or activities that change height
Sports/activities you like that change speed
What are some of other things your group members said they like to do?
Activities in your group that change height
Activities in your group that change speed
Procedure:
On your own choose two activities from the list below different from your group members and
measure the mechanical energy (energy of motion) used in each.
40 yard dash, bar curls, bench press, blurpees, calf rise, curls, crunches, dead lift,
fences, leg press, line jump, lunges, military press, push up, sprints, squats
Use mass in kilograms (1 pound is .45 kg) and speed in meters/second (1 mile/hour is .45 m/s)
Activity 1:
Activity 2:
Mass of object: ______ (pounds) ______ (kg)
Mass of object: ______ (pounds) ______ (kg)
Change in height: _________ (meters)
Change in height: __________ (meters)
Change in speed: __________
(meters/second)
Change in speed: __________
(meters/second)
Two equations to use to estimate the energy in a system.
If there is a change in height: Potential Energy = 10 (m/s2)* mass (kg)* change in height
(meters)
If there is a change in speed: Kinetic Energy = ½ * mass (kg)* speed2 (This is a speed squared)
Energy in Activity 1:
Energy in Activity 2:
The amount of energy you got with this calculation is in a unit called Joules.
To estimate the amount of Calories you burned: you need to divide the energy number by
4000.
Data Analysis:
1. My first activity ___________used _______________Calories of energy.
2. My second activity used ___________used _______________Calories of energy.
3. Of the activities each group member did, which two activities used the most energy? How
much energy was used in each?
1st) Energy Activity: __________ Calories used_________
2nd) Energy Activity: __________ Calories used_________
4. Where did the energy used in your activity come from and what happened to it?
5. How does this amount of energy compare to an 8oz. steak (about 450 Calories) and is that
what you expected?
6. How does the amount of energy your group found compare to the amounts the other groups
found?
7. After hearing about the other groups’ activities, answer the following question: How do the
energies from each model (biological, chemical, physical) compare? (Draw a picture or write the
relationship)
Investigating Factors Affecting the Rate of Photosynthesis
Overview: In this experiment you will determine the rate of photosynthesis by counting the
number of bubbles rising from the cut end of a piece of Elodea. Then, you will convert this into
the amount of energy produced, in Calories. You will work together in groups of 3 students. One
student will act as a timekeeper, one as a bubble counter, and one as a scribe.
Materials:
1 ~600mL Beaker, 600
Yardstick or Ruler
10 cm length of Elodea with paper clip at one end
Scissors
Forceps
Electric lamp
Clamp stand with boss and clamp
Stopwatch
Hot water, Ice, Thermometer
Safety Notes: Normal laboratory safety procedures should be followed. There is a slight risk of
infection from pond water, so wash your hands thoroughly after completing the investigation.
Procedure:
1. Set up the apparatus as shown in a darkened room.
2. Look for a stream of bubbles coming from the cut end of the pondweed.
3. Count the number of bubbles produced in 1 minute.
4. Repeat twice and calculate a mean bubble count – number of bubbles per minute. This is the
mean rate of bubble production.
5. Change the temperature by moving your Elodea sample either to a hot water or ice water
sample.
6. Leave for 2 minutes and then take counts of the number of bubbles produced in one minute.
7. Repeat the count and calculate the mean rate of bubble production as before.
Data Table:
Temperature of
Water (C)
Number of Bubbles Produced (in 1
Minute)
Number of Calories Produced
(in 1 minute) (number of
bubbles divided by 1x106)
1x106 oxygen bubbles equal approximately 1 Cal.
Analysis Questions:
1. How did changing the temperature of the water affect the number of bubbles created?
2. Where did the energy come from and what happened to it?
3. How does this amount of energy compare to an 8oz. steak (about 450 Calories) and is that
what you expected?
4. How does the amount of energy your group found compare to the amounts the other groups
found?
5. After hearing about the other groups’ activities, answer the following question: How do the
energies from each model (biological, chemical, physical) compare? (Draw a picture or write
the relationship)
Energy Transformation: Chemistry: Food Calorimetry Lab
Today we will investigate how energy in food is calculated. In our everyday life, we see that
food is often measured in a Calorie which is a unit of energy. In our lab, we will calculate
energy in Joules, but will convert them to calories which we are more familiar with.
Now in groups of 3-4, as a group you will choose two different foods to test and measure their
energy content. Each person must wear their safety goggles!
Procedures:
1. Wear safety goggles.
2. Pick two foods you want to test. (Food—marshmallow, crackers, cheetoes, etc.)
3. Measure the mass one piece of food on an electric balance. Record its mass in the chart
below.
4. The calorimeter is set-up by using a 50 mL beaker filled with 10 mL of water on a ring stand
with wire gauze on a ring stand.
5. The temperature probe is used to measure the temperature. Record the initial temperature of
the water prior to burning the food with a temperature probe.
6. Hook the food to the end of a bent paperclip that is hooked into a rubber stopper.
7. Place the beaker of 10 mL of water on a ring stand about 1 cm from the food on the
stopper/paper clip set up and light the food on fire using a match.
8. After the food is burned, record the temperature of the water with the temperature probe.
9. Repeat these procedures using one other piece of food.
10. Fnd the difference in temperature of the water before and after burning each food sample.
Data:
Food
Mass (g)
Initial
Temperature
(°C)
Final
Temperature
(°C)
Change in
Temperature
(°C)
Q=mcΔT
(Joules)
Energy*
(Calories)
*To estimate energy in calories—to convert from Joules to calories, divide your Q by 4000.
Analysis Questions:
1. Where did your energy come from and what happened to it?
2. How does this amount of energy compare to an 8oz. steak?
3. How does the amount of energy your group found compare to the amounts the other groups
found?
4. How do the energies from each model (biological, chemical, physical) compare?
(Draw a picture or write the relationship)
Where Do I Belong?
Classifying Your Species Using Evidence
Activity Overview: This lesson uses Cladograms to classify unknown organisms. Students are
given three different Cladograms (based on DNA, the fossil record, morphology) and determine
which Cladogram can easily incorporate an unknown organism (or which Cladogram makes the
most sense). At the end of this lesson, students will be able to classify an unknown organism
based on given Cladograms and will be able to develop a logical argument defended by evidence
to support their unknown classification.
Differentiated Scientific Practices:
● Analyzing and Interpreting Data
● Constructing Explanations
● Engaging in Argument from Evidence
Differentiation Strategy: This lesson is differentiated based on readiness using previously
assigned formative assessments (included below). Students are given more scaffolded support
the reach the same objectives. The students are given different organisms to classify based on
how they perform on the formative assessment. This lesson also offers two different forms of
assessment (written or oral) that can be used depending on learner preferences.
Standards/Benchmarks:
Virginia Standards
 BIO. 6 - The student will investigate and understand bases for modern classification
systems. Key concepts include:
o Structural similarities among organisms;
o Fossil record interpretation;
o Comparison of developmental stages in different organisms;
o Examination of biochemical similarities and differences among organisms; and
o Systems of classification that are adaptable to new scientific discoveries.
Materials:
● Cladograms (based on DNA, fossil record, and morphology);
● Information on unknown organisms (optional: students could also perform their own
research).
Procedure:
● Prior Lesson:
○ In the previous lesson, the teacher introduces Cladograms and what they are used
for. Students should have exposure to learning how to create and read Cladograms
before this lesson.
○ Formative assessment for differentiation (included below): An exit slip to assess
their understanding of Cladograms.
■ If students complete all of the questions correctly or miss one question,
they will be asked to do the least scaffolded version of the activity. If
students miss more than two questions, they will be asked to do the most
scaffolded version.
● Introduction: (10-15 minutes) (See Detailed Lesson Plan)
○ Do-Now Activity
■ Review the answers to the Exit Slip (formative assessment) from the
previous class. Review how to construct the Cladogram and what the
Cladogram tells us about relationships between organisms.
○ Introduce the activity to the students as a challenge/problem that needs to be
solved.
■ “Scientists have discovered a mystery organism and it is your job to figure
out where it belongs on the tree of life! Using the information given about
the new organism and the Cladograms, determine which Cladogram
makes the most sense!”
● Activity (40-45 minutes)
○ Most ready group: Give each group (2-3 students) three different Cladograms:
one based on morphology, one based on the fossil record, and one based on DNA.
Then give the students a new or unfamiliar organism and information about this
organism. Their task will be to determine which Cladogram will be the best fit for
their new organism based on the information given.
○ Less ready group: Give each group (2-3 students) nine different Cladograms:
three based on morphology, three based on the fossil record, and three based on
DNA. Then give the students a common or familiar organism and information
about this organism. Their task will be to choose which Cladogram is the best fit
between the options given. This group will have three “correct” Cladograms
instead of one.
● Debrief (30 minutes)
○ Debrief the activity as a whole class. Ask students to share their decisions with
the class and show the class their three Cladograms and the information about
their organism. Then, present their argument on why they chose a specific
Cladogram. We suggest having students follow an argument model in which they
make a claim supported by evidence. Claims include conjectures, conclusions,
explanations, models, or an answer to a research question. They usually rely on
evidence to support those claims. Scientists must also convince others that their
evidence is relevant and of high quality, so they spend lots of time assessing,
critiquing, justifying and defending the evidence (from The Science Teacher,
Summer 2013 vol. 80 no. 5).
○ Or, debrief by asking the students to discuss what challenges they faced, what
strategies they used, and what more they need to know to make a solid argument.
Modifications:
● Students do their own research on their unknown animal OR can be given the
information on their unknown animal (depending on time).
● Students share their findings and present their information to the class OR they can argue
their ideas in writing.
Assessment Strategies:
● Look at students’ arguments for why they chose one Cladogram over another. This
includes ensuring they included accurate information and used the information
(Cladograms) correctly.
○ Students can do this orally by presenting their organism and Cladograms with
their peers. They can verbally explain why they picked one Cladogram over the
others to the class.
○ Students could also write one-two paragraphs justifying their decision. This may
be more challenging, as some students struggle to convey their thoughts clearly in
writing. However, this would provide students with an opportunity to practice this
skill!
● A second assessment strategy could be used as a summative assessment. Given a new
Cladogram and organism, have students justify whether or not the organism fits and then
explain why.
Source: Lesson developed by Davis Tran and Mary Duff of University of Virginia Curry School
of Education.
Exit Slip & Cladogram Practice
(Formative Assessment)
Directions: Use the chart below to create a Cladogram! Then answer the questions below.
Clam
Backbone
Bony Skeleton
4 limbs
Amniotic Egg
Shark
Bluegill
Salamander
Iguana
Alligator
Crow
Raccoon
Human
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
Hair
2 Openings
behind eye
Opening in
front of eye
X
X
X
X
X
1.
Based on the Cladogram above, which two organisms are the most closely related? How
do you know?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
2.
Based on the Cladogram above, which two organisms are the least closely related? How
do you know?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
36
Where Do I Belong? Classifying Your Mystery Organism Through Evidence
Group 1
Directions: As a biologist-in-training, your job is to make sense of the great biodiversity we have on this Earth! Biologists do not
only need to keep track of evolutionary relationships between organisms (who’s related to who), but also provide evidence to support
these relationships (why they are related). You will be constantly asked “How are any two organisms related?” and you need to be
ready to give a well thought out response rooted in scientific evidence!
Today, you will be given a mystery organism. You are to then formulate a hypothesis on how to best classify your organism in the
given cladogram. The true task, however, is to construct an explanation using evidence from morphological characters, namely the
fossil record.
To succeed in this mission, please follow these instructions closely!
1) PART I: Meeting Your Mystery Organism
 Read the MYSTERY ORGANISM INFORMATION SHEET carefully. As you read, think about which other animals
might be related to your mystery organism.
2)
PART II: Meeting Your Mystery Organism’s Potential Cousins
 Analyze the PRELIMINARY CLADOGRAM. This cladogram represents how scientists think these animals are
related. Your task is to hypothesize, using what you read in the MYSTERY ORGANISM INFORMATION SHEET
and any prior knowledge you may have, where your organism will fit in this cladogram. You must provide supporting
evidence to defend your classification.
3)
PART III: Digging for Evidence—Analyzing the Fossil Record.
 Analyze the FOSSIL RECORD. This is a collection of fossils that helped scientists determine which organisms are
more closely related. As you compare your mystery organism’s fossil to other fossils, make observations about any
similarities or differences they share. Revisit your initial hypothesis and explain how the fossil record helped confirm
or change your hypothesis.
Good luck!
37
Part I: Meeting Your Mystery Organism
MYSTERY ORGANISM INFORMATION SHEET
Common Name: Killer Whale
(Representative of Whales)
Habitat: Marine
General Description: Whales are large and aquatic. They have
inhabited the seas for eons and they can be as large as the biggest
commercial airplane (Boeing 747). In fact, their arteries are so big
that even a human child can crawl through!
Distinguishing Features: Whales have pelvic bones that are separated from
the backbone (spine). This separation allowed whales to have a tail fin that
flaps side-to-side rather than up-and-down like most fish. This up-and-down
motion is very similar to land animals, like dogs. You can easily see this
when a dog runs—its backbone shifts up and down, rather than side to side.
After meeting your mystery organism, hypothesize what other animal shared the same common ancestor as the whale. Be
sure to explain what led you to this conclusion. You may use information from this sheet or any prior knowledge.
HYPOTHESIS: __________________________________________________________________________________________.
REASON(S):_____________________________________________________________________________________________
______________________________________________________________________________________________________
38
Part II: Meeting Your Mystery Organism’s Potential Cousins
PRELIMINARY CLADOGRAM
Directions:
This cladogram shows the evolutionary relationship between 7 different aniamls. Your job
is to figure out where your mystery organism, the whale, belongs on this diagram.
Whale
Is the whale more closely related to fish or land mammals?
 If you think the whale is more related to fish, why?
 If you think the whale is related to a land mammal, which mammal is the whale
most related to?Why?
Be sure to give resaons to support your hypothesis!Record your responses below:
HYPOTHESIS: ________________________________________________
______________________________________________________________
______________________________________________________________
______________________________________________________________
REASONS: ___________________________________________________
_____________________________________________________________
_____________________________________________________________
_____________________________________________________________
39
PART III: Digging For Evidence—Analyzing the Fossil Record
Directions: How was it, digging for fossils for the very first time? After a hard day at
work, you finally got the chance to sit back and look at the fossils you collected. Neatly
organized in rows and columns, you pick up the first fossil in your left hand, analyzing it
intently. Then, you pick up your mystery organism’s fossil. You stare, engrossed, back and
forth, back and forth. One fossil after another, you begin to make comparisons.
Be sure to look for similarities and differences between your mystery organism’s fossil and
the other fossils you collected. Do you want to change where your mystery organism
belongs on the cladogram? Why or why not? Be sure to provide supporting evidence using
the fossil record! Record your responses below.
Based on your generalizations from the fossil record…
1. Did the fossil record help support or reject your hypothesis (of where you think
your mystery organism should fit in the preliminary organism)? Why or why not?
2. Which organism is most closely related to your mystery organism? Put another
way, your mystery organism most likely shared a common ancestry with what other
animal? How do you know?
3. After analyzing the fossil record, can you say, with 100% confidence, that your hypothesis is correct? Explain.
40
THE FOSSIL RECORD (Group 1)
Directions:
Name
Compare the ankle bone of each animal. Based on this fossil record, which animal do you think is most related
to your mystery organism? Why? Use EVIDENCE to support your classification!
Ankle Bone Fossil
Cow
Name
Ankle Bone Fossil
Whale
Camel
Pig
Fish
Deer
Peccary
Hippo
Name
Ankle Bone Fossil
No ankle bone.
41
PART IV: DNA ANALYSIS1
Background: Your quest to uncover the ancestry of your mystery
organism continues. After analyzing the fossil record, you decided to
send samples of bone tissue to the DNA lab.
As we learn the DNA sequences of more and more organisms, we can
compare corresponding sequences to see which living species have
DNA that is most alike. As the DNA for a particular gene is inherited
by new descendent species, and time passes, mutations can occur
(replacements of former DNA bases by different bases), many
without any significant effect. The more time that has passed (the
more distant the ancestry), the more mutations will have occurred,
and the more differences we will find.
You will be provided with 8 DNA segments from the gene for betacasein, a milk protein found in all mammals. The segment is 60 base pairs (bp) long, from bp 141 to bp 200 in the gene. That same
corresponding segment is presented for all 8 species. Your task is to determine which animal’s DNA best matches the whale DNA.
The closer the match, the more related they are.
Directions: Cut apart the strips to align pairs and count the number of differences between any two
organisms. Align the DNA segments from two species, and count the number of letters where the
bases differ. For each pair of species compared, place the number of differences in the appropriate box
on the next page. You should first compare the WHALE DNA sequence to each of the other
organisms. Then, compare cow DNA to deer DNA, cow DNA to hippo DNA, cow DNA to hippo
DNA and so on. You should have 28 comparisons by the end of this assignment. Record answers on
DNA DIFFERENCES TABLE CHART.
1
Adapted from Larry Flammer. http://www.indiana.edu/~ensiweb/lessons/wh.a%26d.les.html
42
DNA ANALYSIS (Group 1):DNA segment (base pairs number 141-200) for beta casein, a milk protein.
Directions: Cut apart the strips to align pairs and count the number of differences between any two organisms. You
should first compare the WHALE DNA sequence to each of the other organisms. Then, compare cow DNA to deer
DNA, cow DNA to hippo DNA, cow DNA to hippo DNA and so on. You should have 28 comparisons by the end
of this assignment. Record answers on DNA DIFFERENCES TABLE CHART.
Name
DNA Sequence
Cow
AGTCCCCAAAGTGAAGGAGACTATGGTTCCTAAGCACAAGGAAATGCCCTTCCCTAAATA
Deer
AGTCTCCGAAGTGAAGGAGACTATGGTTCCTAAGCACGAAGAAATGCCCTTCCCTAAATA
Hippo
AGTCCCCAAAGCAAAGGAGACTATCCTTCCTAAGCATAAAGAAATGCCCTTCTCTAAATC
Pig
AGATTCCAAAGCTAAGGAGACCATTGTTCCCAAGCGTAAAGGAATGCCCTTCCCTAAATC
43
Peccary
AGACCCCAAACCTAAGGAGACCGTTGTTCACAAGCGTAAAGGAATGTCCTCCCCTAAATC
Camel
TGTCCCCAAAACTAAGGAGACCATCATTCCTAAGCGCAAAGAAATGCCCTTGCTTCAGTC
Fish
TGTCACGCCTAAGTGGCCAGTCCATATCCTAGCCCCAAGCTATGCTCTTCAATGATCATC
Whale
AGTCCCCAAAGCTAAGGAGACTCTCCTTCCTAAGCATAAAGAAATGCCCTTCCCTAAATC
44
DNA DIFFERENCES TABLE CHART
Directions: Record the number of differences in DNA sequence between two organisms below. Look for the first organism in the first
column and your second organism is the last row. Where the two meet is where you should write the number of DNA differences
between this pair of organisms. Remember, the larger the amount of DNA differences, the more distant these two organisms are from
one another.
Cow
Deer
Hippo
Pig
Peccary
Camel
Fish
Whale
Cow
Deer
Hippo
Pig
Peccary
Based on your analysis of DNA comparisons…
1. Has your DNA comparisons helped support or reject your hypothesis? Explain.
Camel
45
Closing the Case
1. Now, let’s revisit our first question. Which animal is most closely related with your mystery organism? How do you know?
What evidence can you provide given your analysis of the fossil record and DNA sequences?
2. Based off of your explanation and supporting evidence, draw a cladogram with all the animals you looked at below.
46
Homework
Congratulations! You just solved your first evolution case! Not only were you able to give a working hypothesis,
you provided EVIDENCE to support it! However, the job is not done there. The data you collected and the
explanation you constructed still needs to reviewed by other members in the scientific community. Read the
scenario below and in at least 5 sentences, write your response below.
Scenario: A group of visiting scientists from Sweden analyzed your report, and are still not convinced . They
believe the whale is closely related to fish, not mammals. Which pieces of evidence can you provide to
strengthen your argument? Write a letter defending your hypothesis and BE SURE TO GIVE EVIENCE,
explaining why your hypothesis is correct. Be sure to incorporate both fossil record and DNA sequence analysis
in your response.
47
Where Do I Belong? Classifying Your Mystery Organism Through Evidence
Group 2
Directions: As a biologist-in-training, your job is to make sense of the great biodiversity we have on this Earth! Biologists do not
only need to keep track of evolutionary relationships between organisms (who’s related to who), but also provide evidence to support
these relationships (why they are related). You will be constantly asked “How are any two organisms related?” and you need to be
ready to give a well thought out response rooted in scientific evidence!
Today, you will be given a mystery organism. You are to then formulate a hypothesis on how to best classify your organism in the
given cladogram. The true task, however, is to construct an explanation using evidence from morphological characters, namely the
fossil record.
To succeed in this mission, please follow these instructions closely!
4) PART I: Meeting Your Mystery Organism
 Read the MYSTERY ORGANISM INFORMATION SHEET carefully. As you read, think about which other animals
might be related to your mystery organism.
5)
PART II: Meeting Your Mystery Organism’s Potential Cousins
 Analyze the PRELIMINARY CLADOGRAMS. There are currently three cladograms that show the relationship
between your mystery organism and a few other animals. Your taks is to PICK ONE hypothesis. Read the MYSTERY
ORGANISM INFORMATION SHEET and any prior knowledge you may have to determine which cladogram (or
hypothesis) is correct. You must provide supporting evidence to defend your classification.
6)
PART III: Digging for Evidence—Analyzing the Fossil Record.
 Analyze the FOSSIL RECORD. This is a collection of fossils that helped scientists determine which organisms are
more closely related. As you compare your mystery organism’s fossil to other fossils, make observations about any
similarities or differences they share. Revisit your initial hypothesis and explain how the fossil record helped confirm
or change your hypothesis.
Good luck!
48
Part I: Meeting Your Mystery Organism
MYSTERY ORGANISM INFORMATION SHEET
Common Name: Humans
Habitat: Terrestrial (Land)
General Description: Humans are creatures you are
probably (I hope!) very familiar with. We live on land,
require oxygen to survive, and cannot make our own
food (like the way plants do with photosynthesis). We
are considered as primates, a special group of mammals.
Distinguishing Features: Humans have a number of
traits that are unique among extant primates: We walk
using two feet, we have very large brains, we make and
use complex tools, and we use language. More importantly,
humans have something called an opposable thumb, a thumb
that allows us to grab onto things. What’s special about the
human thumb is that humans have three muscles that most
primates lack.
After meeting your mystery organism, hypothesize what other animal shared the same common ancestor as the whale. Be
sure to explain what led you to this conclusion. You may use information from this sheet or any prior knowledge.
HYPOTHESIS: __________________________________________________________________________________________.
REASON(S):_____________________________________________________________________________________________
_________________________________________________________________________________________________________
49
Part II: Meeting Your Mystery Organism’s Potential Cousins
PRELIMINARY CLADOGRAM
Which hypothesis is correct?
Directions:
The cladograms on the left show three possible evolutionary
relationships between gorillas, chimpanzees, and humans. Based on
your prior knowledge, which hypothesis do you think is right?
Are humans more closely related to gorillas (Hypothesis 2),
chimpanzess (Hypothesis 3), or did all three species originate from
the same recent common ancestor (Hypothesis 1)?
Be sure to give resaons to support your hypothesis!Record your
responses below:
Key:
G: Gorilla
C: Chimpanzee
H: Human
A: Common Ancestor
HYPOTHESIS & REASONS
I think hypothesis number _______ is correct because:
_______________________________________________
_______________________________________________
_______________________________________________
_______________________________________________
_______________________________________________
_______________________________________________
______________________________________________.
50
PART III: Digging For Evidence—Analyzing the Fossil Record
Directions: How was it, digging for fossils for the very first time? After a hard day at
work, you finally got the chance to sit back and look at the fossils you collected. Neatly
organized in rows and columns, you pick up the chimpanzee skull in your left hand,
analyzing it intently. Then, you pick up a human skull. You stare, engrossed, back and
forth, back and forth. One fossil after another, you begin to make comparisons.
Be sure to look for similarities and differences between the human skull and the other
skulls you collected. Do you want to change the hypothesis you chose? Why or why not?
Be sure to provide supporting evidence using the fossil record! Record your responses
below.
Based on your generalizations from the fossil record…
4. Did the fossil record help support or reject the hypothesis you chose? Why or why
not?
5. Which organism is most closely related to humans? Put another way, are humans
more closely related to gorillas or chimpanzees? How do you know?
6. After analyzing the fossil record, can you say, with 100% confidence, that the hypothesis you chose is correct? Explain.
51
THE FOSSIL RECORD (Group 2)
Directions:
Compare the bone of each animal. Based on this fossil record, which animal do you think is most related to
your mystery organism? Why? Use EVIDENCE to support your classification!
Name
Gorilla
Fossil
Name
Chimpanzee
Fossil
Name
Human
Fossil
52
PART IV: DNA ANALYSIS2
Background: Your quest to uncover the ancestry of your mystery
organism continues. After analyzing the fossil record, you decided to
send samples of bone tissue to the DNA lab.
As we learn the DNA sequences of more and more organisms, we can
compare corresponding sequences to see which living species have DNA
that is most alike. As the DNA for a particular gene is inherited by new
descendent species, and time passes, mutations can occur (replacements
of former DNA bases by different bases), many without any significant
effect. The more time that has passed (the more distant the ancestry), the
more mutations will have occurred, and the more differences we will
find.
You will be provided with 4 DNA segments from the gene for
hemoglobin, a protein that carries oxygen in blood. The segment is 20 base pairs (bp) long. That same corresponding segment is
presented for all 3 species. Your task is to determine which animal’s DNA best matches human DNA. The closer the match, the more
closely related they are.
Directions: Cut apart the strips to align pairs and count the number of differences between any two organisms. Align the DNA
segments from two species, and count the number of letters where the bases differ.
VARIATION: OR, you may make DNA models using colored paper clips.
Synthesize DNA strands by connecting colored paper clips. Each different color of paper clip represents one of the four bases of DNA:
Black = adenine (A)
White = thymine (T)
Green = guanine (G)
Red = cytosine (C)
2
Adapted from Teaching Evolution and the Nature of Science, National Academy of Sciences
53
DNA ANALYSIS (Group 2):DNA segment for hemoglobin, a blood protein.
Directions: Cut apart the strips to align pairs and count the number of differences between two organisms. You should first compare
the HUMAN DNA sequence to each of the other organisms. Record answers on DNA DIFFERENCES TABLE CHART.
Name
DNA Sequence
A-G-G-C-C-C-C-T-T-C-C-A-A-C-C-A-G-G-C-C
Gorilla
A-G-G-C-C-C-C-T-T-C-C-A-A-C-C-G-A-T-T-A
Chimpanzee
A-G-G-C-A-T-A-A-A-C-C-A-A-C-C-G-A-T-T-A
Human
54
DNA DIFFERENCES TABLE CHART
Directions: Compare human DNA to chimpanzee DNA and Gorilla DNA. Record number of matched bases and unmatched bases
below.
Data for human DNA
Human DNA compared to:
Number of matches
Unmatched bases
Chimpanzee DNA
Gorilla DNA
Based on your analysis of DNA comparisons…
2. How did the gorilla DNA compare to the human DNA?
3. How did the chimpanzee DNA compare to the human DNA?
4. Between the gorilla DNA and chimpanzee DNA, which is more similar to human DNA? How do you know?
5. What does this data suggest about the relationship between humans, gorillas, and chimpanzees?
6. Has your DNA comparisons helped support or reject the hypothesis you chose? Explain.
7. Has your DNA comparisons helped support or reject your conclusions from the fossil record? Explain.
55
Closing the Case
3. Now, let’s revisit our first question. Which hypothesis and which cladogram correctly shows the evolutionary relationship
between humans, gorillas, and chimpanzees? How do you know? What evidence can you provide given your analysis of the
fossil record and DNA sequences?
4. Based off of your explanation and supporting evidence, draw a cladogram with all the animals you looked at below.
56
Homework
Congratulations! You just solved your first evolution case! Not only were you able to give a working hypothesis,
you provided EVIDENCE to support it! However, the job is not done there. The data you collected and the
explanation you constructed still needs to reviewed by other members in the scientific community. Read the
scenario below and in at least 5 sentences, write your response below.
Scenario: A group of visiting scientists from Sweden analyzed your report, and are still not convinced. They
believe that humans are more closely related to gorillas than chimpanzees. Which pieces of evidence can you
provide to strengthen your argument? Write a letter defending your hypothesis and BE SURE TO GIVE
EVIENCE, explaining why your hypothesis is correct. Be sure to incorporate both fossil record and DNA
sequence analysis in your response. You may use the letter template below, or create your own on the back.
Dear Sweden Scientists,
I believe that my hypothesis is correct. There are many pieces of evidence to support my hypothesis. After looking at the fossil
record, the fossils show that
____________________________________________________________________________________________________________
____________________________________________________________________________________________________________
___________________________________________________________________________________________________________.
This supports my hypothesis.
After comparing the DNA sequences between humans, gorillas, and chimpanzees, the comparisons show that
____________________________________________________________________________________________________________
____________________________________________________________________________________________________________
___________________________________________________________________________________________________________.
This also helps to support my hypothesis.
In conclusion, these evidences suggest that ____________________________________________________
__________________________________________________________________________________________________________.
57
Resources for Implementing Inquiry, Scientific Practices, and Differentiation
in Science Classrooms
Inquiry
Bell, R. L., Smetana, L., & Binns, I. (2005). Simplifying inquiry instruction. The Science
Teacher, 72(7), 30-33.
Wheeler, L.B. & Bell, R.L. (2012). Open-ended inquiry: Practical ways of implementing the
most challenging form of inquiry. The Science Teacher, 79(6), 32-39.
Whitworth, B. A., Maeng, J. L., & Bell, R. L. (2013, October). Differentiating inquiry. Science
Scope, 37(2), 10-17.
Differentiation
Books
Marzano, R. J., Pickering, D. J. & Pollock, J.E. (2001). Classroom Instruction that Works.
ASCD.
Tomlinson, C. A. (2003). Fulfilling the Promise of the Differentiated Classroom: Strategies and
Tools for Responsive Teaching. ACS
Tomlinson, C. A. (2001). How to Differentiate Instruction in Mixed Ability Classrooms. ASCD.
Tomlinson, C. A. (1996). Differentiating Instruction for Mixed Ability Classrooms. ACSD.
Tomlinson, C. A. & Imbeau, M. B. (2010). Leading and Managing a Differentiated Classroom.
ACSD.
Tomlinson, C. A. & McTighe, J. (2006). Integrating Differentiated Instruction and
Understanding by Design. ACSD.
Tomlinson, C. A. & Strickland, C. (2005). Differentiation in Practice: A Resource Book for
Differentiating Curriculum, Grades 9 – 12. ACSD.
Wiggins, G. & McTighe, J. (1998). Understanding by Design. ASCD.
Wormeli, R. (2006). Fair isn’t always equal: Assessing and grading in a differentiated
classroom. Stenhouse Publishers
Articles
Whitworth, B. A., Maeng, J. L., & Bell, R. L. (2013, October). Differentiating inquiry. Science
Scope, 37(2), 10-17.
Gonczi, A.L. & Maeng, J.L. (in review). Ocean Acidification: Differentiated Science Instruction.
Science Activities.
Differentiation Central Website: http://www.differentiationcentral.com/
Scientific Practices
Wheeler, L. B., Maeng, J. L. & Smetana, L.K. (2014). Incorporating argumentation through
forensic science. Science Activities: Classroom Projects and Curriculum Ideas, 51(3),
67-77.