Construction of the Stim1 Knockout Mouse — The cell line, GST050 is publicly available from the Gene Trap Resource at http://baygenomics.ucsf.edu. The sequence was obtained by 5' RACE PCR from a mouse ES cell clone with an insertional mutation from a gene trap vector. A portion of DNA containing the -galactosidase reporter gene with the neomycin resistance gene was inserted randomly into the genomic DNA (Baygenomics, San Francisco, California). The insertion of the portion of artificial DNA into the genome disrupts the RNA splicing machinery, resulting in prevention of protein translation. This insertion can be identified using the activity of the artificial reporter gene, with the activity of the disrupted gene in mouse tissue also monitored. The Stim1 gene is located on chromosome 7 at site 20137335 with the accession number NM_009287.4. The ES cell line, GST050, transfected with the gene-trap vector pGT1TMpfs (BayGenomics, University of San Francisco, San Francisco, California) contains the first 3 exons of the Stim1 gene with the disruption vector containing -galactosidase-neomycin inserted at 124 aa of the mRNA, corresponding to 120847 bp of the Stim1 gene in Intron 3-4 of the genomic DNA as identified by using partial Inverse PCR (see below). The BayGenomics ES cell line was generated from 129P2 (formerly 129/Ola) ES cell lines {Nichols, 1990 #8588}). Parental cell lines (CGR8 and E14Tg2A) were established from delayed blastocysts on gelatinized tissue culture dishes in ES cell medium containing LIF {Nichols, 1990 #8588}. Sub-lines were isolated by plating cells at a single-cell density, picking, and expanding single colonies, and testing several clones for germ-line competence. The single clone ES cell line was passaged for six days in ES cell medium (GMEM, 2 mM glutamine, 1 mM sodium pyruvate, 1 X non-essential amino acids, 10% FCS, 1:1000 dilutionmercaptoethanol, and 1000 U LIF (leukemia inhibitory factor - necessary for the maintenance of undifferentiated embryonic stem cells) in the absence of neomycin. On the day of injection, the medium was changed several hours before harvesting the cells. A confluent 25 cm 2 flask was trypsinized for 4 minutes and diluted into 9 mL of cold ES cell medium without LIF, pelleted, and resuspended in 0.8 mL of ES cell medium (without LIF) in a sterile 1.5 mL screw-top microcentrifuge tube. Before they were added to the injection chamber, cells were kept on ice (for up to several hours) to prevent clumping. Blastocysts were flushed from pregnant C57BL/6 females and collected into a CO2-independent medium containing 10% FCS. Blastocysts were expanded for one to two hours in ES cell medium in a 37°C/5% CO2 incubator, transferred to a hanging drop chamber, and cooled to 4°C. ES cells were added to the hanging drops, and the blastocysts are injected with enough cells (20 or more) to fill the blastocoele. Injected blastocysts were then transferred to pseudo pregnant recipient females (10-15 blastocysts/uterine horn). Typically, injection of 10 blastocysts will yield an average of twice male chimeras with germline mosaicism. These ES cells were microinjected into 3.5-d-old C57BL/6J blastocysts to generate chimeric mice. Chimeric males were analyzed for germline transmission by mating with C57BL/6J females, and the progeny were analyzed by PCR analysis, -galactosidase staining, and Southern blot analysis (See below). Deficient mice were generated in the HSLAS facility at the University of Alberta with the assistance of Dr. P. Dickie. To identify where the Stim1 gene was disrupted, partial Inverse PCR was utilized (Laurent Vergnes and Karen Reue). This involved using specific primers against the 3’ end of the gene-trap disruption vector, digesting the DNA, ligating the DNA into small circular DNA fragments and performing nested PCR. Genomic DNA was isolated from -galactosidase staining identified heterozygote tail clippings and the integrity of the vector was identified by using standard PCR with one specific forward primer and three reverse primers to determine whether the 3’ end of the vector had been degraded, which is an unfortunate common occurrence in gene trapping. The sequence of the gene-trap vector was downloaded from the BayGenomics website. Forward primer: Reverse primer 1: pGTCF pGTCR1 5’-GGTCTGACGCTCAGTGGAACG-3’ 5’-GGGATCATGTAACTCGCCTTG-3’ Reverse primer 2: Reverse primer 3: pGTCR2 pGTCR3 5’-GAAGATCAGTTGGGTGCACG-3’ 5’-CATCCCCCTTTCGCCAGCT-3’ Standard PCR identified partial degradation occurring at the 3’ end of the plasmid downstream of the third primer pGTCR3. This dictated the use of Inverse PCR using specific primer set B, INVF3, INVR3, INVF4, and INVR4. INVF3, GTACTGAGAGTGCACCATATGC INVR3, AGTTAAGCCAGCCCCGACACC INVF4, GCACAGATGCGTAAGGAGAA INVR4, ACCCGCCAACACCCGCTG Genomic DNA was digested with BfaI, an enzyme that has multiple sites of cleavage in genomic DNA as well as the vector, digesting the DNA into small fragments, one of which hopefully contains a portion of the disruption vector followed by a portion of the calnexin gene. The DNA is purified using a PCR purification kit (Qiagen) and the small fragments are ligated using the Rapid DNA Ligation Kit (Boehringer) to generate small circular DNA fragments. Inverse PCR was done using 20 ng of ligation reaction and primer set, INVF1 and INVR1. Product was purified using QIAquick Gel Extraction Kit (Qiagen). If no band is observed, a small portion of the PCR product was used to perform a nested PCR using the primer set, INVF3 and INVR3. After the second PCR, the product was purified and send for sequencing. The sequence obtained contained gene-trap vector followed by sequence specific to the Stim1 gene, identifying the insertion site of the gene-trap vector as bp 2451 of Intron 3-4. Using this information, primers were designed that utilized the inserted gene-trap vector as a forward primer, INVF3 and a reverse primer, Stim1R5, located in Intron 3-4 of the Stim1 sequence to detect the disrupted strand, giving a PCR product of 300 bp. To detect wild type strand, a forward primer Stim1F4 and Stim1R6 were designed that correspond to either side of the insertion site in Intron 3-4, giving a PCR product of 1100 bp. I “walked” down intron 3-4 with primers to identify where the stim1 gene was disrupted and send PCR product for sequencing: pGT1.8TM disruption vector linker region Stim1 intron 3-4 Ttgtaaaacgacggccagtgccaagctt ccggtacatgatcgaggggactgacaagacgg cctcccgcagttaaatgttaaa… To Identify disruption I used two sets of primers with genomic DNA: Genotype genomic knockout strand with: INVF3, GTACTGAGAGTGCACCATATGC Stim1R5 5’-cagtagacagcctgcattgc-3’ Size: 300 bp Genotype genomic wild type strand with: Stim1F4 5’-cagtgcacttccttgtcagctg-3’ Stim1R6 5’-ccgtctatgactccatggcag-3’ Size: 1100 bp Protein Product: 14 kDa fragment + 178 kDa b-gal Engrailed fragment: 124 aa: M D V C A R L A L W L L W G L L L H Q G Q S L S H S H S E K N T G A S S G A T S E E S T E A E F C R I D K P L C H S E D E K L S F E A V R N I H K L M D D D A N G D V D V E E S D E F L R E D L N Y H D P T V K H S T F H G E D K L I S V E D L W K A W K S S E 1-22: signal sequence 23-213: luminal domain 214-234: transmembrane domain 132-200: SAM domain 63-98: EF hand 76-87: Calcium binding domain 248-388: Coiled Coil domain Sequence of Stim1 that will still be present: ATGGATGTGTGCGCCCGTCTTGCCCTGTGGCTTCTTTGGGGGCTCCTTCTGCATCAGGGCCAGAGTCTCAGCCATA GTCACAGTGAAAAGAATACAGGAGCTAGCTCCGGGGCGACTTCTGAAGAGTCTACCGAAGCAGAGTTTTGCCGAA TTGACAAGCCCCTGTGCCACAGTGAGGATGAGAAGCTCAGCTTTGAGGCCGTCCGAAACATCCATAAGCTGATGG ATGACGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTAAGGGAAGACCTCAATTACCATGACC CAACAGTGAAACATAGCACCTTCCATGGTGAGGATAAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAG TCATCAGAA