Additional file 1:
Supplementary information 1: Method: HEK293T cells (2x106) were seeded in 6well plates. Then, 24 h later, cells were transiently transfected with pEGFP-C1 or pEGFPsurvivin (5g) using Lipofectamine 2000 as described by the manufacturer. After
another 24 h, cells were harvested, centrifuged and stored at -80°C. Total RNA was
isolated with the reagent TriZOL™ following instructions provided by manufacturer. To
label cDNA, 20 g of total RNA was reverse transcribed in the presence of Alexa-647 or
Alexa-555-dUTPs. Further details on fluorescent cDNA labeling, hybridization and
washes have been described elsewhere (Urzua et al., 2006). A dye-swap microarray
experiment was conducted using Whole genome HEEBO (Human Exonic Evidence Based
Oligonucleotide) microarrays (Microarrays Inc, Huntsville, AL). Microarrays were
scanned at 10 m resolution in a ScanArray Lite (Perkin Elmer, CA) fluorescence scanner.
Scanned images were saved in TIFF format and then extracted with the GenePix Pro III.
Green/red and red/green ratios were obtained for every gene and then were separated
in 3 categories depending on the magnitude of relative expression referred to as:
“increased”, “no change” and “repressed”. Result: The relative expression patterns (GFP
control as 1) were evaluated by microarray analysis for Wnt pathway target genes upon
GFP-Survivin overexpression. For 12 of the genes evaluated, no change was observed in
the presence of survivin, while for 10 genes survivin-enhanced expression was detected.
Only 3 target genes of the Wnt pathway were repressed in the presence of survivin; of
these 2 (SOX-9 and P16ink16) are known to be down regulated by the Wnt pathway.
Table 1: Changes in Wnt pathway
target genes induced by GFP-survivin
expression. Microarray analysis was
employed to evaluate changes in Wnt
target genes expression. A: Genes
with increased expression (Percentile
70-100), B: Genes that didn’t change
(Percentile 35-65) C: Genes that were
repressed (Percentile 0-30). (The
complete microarray dataset is
available from the Gene Expression
Omnibus
(GEO;
http://www.ncbi.nlm.nih.gov/geo/)
repository,
under
the
code
GSE43817)
Supplementary information 2: Method: ZR-75 cells were cultured in DMEM-F12
medium supplemented with 10% FBS and antibiotics (10,000 U/ml penicillin and 10
mg/ml streptomycin). Downregulation of survivin in ZR75 cells was achieved by
transfection in 6-well plates with plasmids containing shRNA directed against human
survivin inserted in the vector pGFP-V-RS purchased from ORIGENE. The sequences used
were:
GATGGCCGAGGCTGGCTTCATCCACTGCC
(902),
CAGTGTTTCTTCTGCTTCAAGGAGCTGGA (903), CTTTCCTTTCTGTCAAGAAGCAGTTTGAA
(904), GAGAAAGTGCGCCGTGCCATCGAGCAGCT (905) and a scrambled sequence
GCACTACCAGAGCTAACTCAGATAGTACT. Once transfection efficiency reached 50%
(checked by green fluorescence), cells were detached and 20-30 cells were seeded in 10
cm plates. Green-fluorescent colonies were selected and reseeded individually in 6-well
plates and periodically treated with puromycin (1mg/mL). Ten clonal populations were
obtained: clones 1-4, scrambled shRNA, clones 5-10, shRNA against survivin (clones 5,6:
sh sequence 902; clones 7-10: sh sequence 905). Result: Downregulation of survivin in
clones 5 and 10 significantly reduced -catenin protein levels as compared to levels
detected in clone 1 control cells.
Supplementary Fig. 2. Survivin downregulation
decreased β-catenin protein levels in ZR-75
breast cancer cells: ZR-75 cells were stably
transfected with shRNA directed against human
survivin or a scrambled sequence. Clonal
populations were obtained from green fluorescent
cells: Clon 1, scrambled shRNA, clones 5 and 10,
shRNA directed against human survivin. β-catenin ,
survivin, and actin protein levels were evaluated by
western blotting. Protein levels were quantified by
scanning densitometric analysis of western blots
and normalized to actin. Numerical data shown are
the means of results obtained in three independent
experiments. Statistically significant differences
compared to scrambled shRNA controls are
indicated (* p<0.05).
Supplementary information 3:
Method: HEK293T cells were transiently
transfected with pEGFP-C1 or pEGFP-survivin (1.5g) using Lipofectamine 2000 as
described by the manufacturer, and treated with inhibitors. Then, 24 h later, cells were
harvested, centrifuged and stored at -80°C. Upon thawing, cell extracts were prepared
and submitted to western-blot analysis as described. The inhibitor bisindolylmaleimide
(BIM) was from Alexis (San Diego, CA) and the inhibitor glycerocarbonate and 2Dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole (DMAT) was from Calbiochem
(San Diego, CA). Result: The effects of inhibiting 3 different pathways on survivin
induced changes were evaluated with pharmacological inhibitors. Only the PI3K
inhibitor (LY294002) suppressed the ability of survivin overexpression to increase catenin protein levels (Supplementary Figure 3).
Inhibitors
Supplementary Fig 3.
PI3K
inhibition
suppressed
survivin
enhanced
-catenin
protein levels: HEK293T
 -catenin
1.0
1.6
2.6*
1.1
1.7*
1.3
1.8*
1.2
0.8
cells (5x105) were seeded
in 6-well plates and
Survivin
transfected with pEGFP1.0
1.5
2.3*
1.0
1.9*
1.6
2.0*
1.3
0.9
C1 or pEGFP-survivin (1.5
Actin
g). After transfection,
cells were treated with
+
+
+
+
pEGFP -C1
DMAT (CK2 inhibitor, 50
pEGFP -survivin
+
+
+
+
M), BIM (PKC inhibitor,
0.5 M) or LY294002
(PI3K inhibitor, 20 M). After 24 h, -catenin, survivin and actin protein levels were
evaluated by western blotting. Protein levels were quantified by scanning densitometric
analysis of western blots and normalized to actin. Numerical data shown are the means
± s.e.m. of results obtained in three independent experiments. Statistically significant
differences compared to mock controls are indicated (*= p<0.05).
DMAT (CK -2)
BIM (PKCs)
LY294002 (PI3K)