Chapter 25 Molecular Inheritance
TGT Questions
1. Draw a timeline with each of the 6 scientists (or groups of scientists) we talked about and their major contributions to the discovery of DNA and it’s structure.
2. Draw a double strand of DNA and label each of the following: Deoxiribose, phosphate group, adenine, guanine, cytosine, thymine (label and include H bonds), and nucleotide.
3. Draw and label a strand of RNA. Include and label the following sugar (which kind), phosphate group, nitrogen bases A,
U, G, C (label which one), and nucleotide
4. List at least 3 differences between DNA and RNA?
5. How are purines and pyrimidines different? Make a table that includes the purines and pyrimidines found in DNA and include uracil from RNA.
6. List, in order, the steps of replication. Make sure to include all the enzymes and their roles….be specific!

7. List and describe each step of transcription. Make sure to include the promoter, enzymes, and introns & exons.
8. List and describe each step of translation. Make sure to include ribosomes, tRNA, anticodons, amino acids and polypeptides.
9. If I have a 5’ to 3’ strand of DNA AACGTGTGTAGTCTGATCGAC, what would the 3’ to 5’ strand be?
10. If a NON -coding strand of DNA is atgcgtgattagcgatgggaaaaaaaaa, what would my amino acids be?
11. What are the 3 major types of mutations we talked about?
12. What is a transposon?
13. What is mRNA and why is it important?
14. What is a leading strand?
15. What is the monomer for all nucleic acids?
16. DNA takes the form of a
17. Which form of RNA binds to amino acids?
18. List the parts of a nucleotide.
19. What does the term semiconservative mean?
.

20. How does damaged DNA get repaired?
21. What do ribozymes do?
22. A change in a single nucleotide in DNA may cause a mutation.
23. What is the name of the process that turns RNA codons into amino acid sequences?
24. Which nucleic acid is single stranded?
25. A change in the sequence of nitrogen bases in DNA is a
26. What is the function of ligase?
27. How many nucleotides would you need to code for 20 amino acids?
28. What kind of bond joins amino acids to one another?
.
29. What kind of bond joins nitrogen bases in DNA?
30. Guanine always bonds with ______ .
31. A region of DNA that codes for a protein is known as a
32. Where in a cell can you find RNA?
33. What is an exon?
_____ .
34. What is the function of a proto-oncogene?
35. What is the name of the enzyme responsible for joining sugar/phosphate groups during replication?
36. How many nitrogen bases are there in a codon?
37. What is an Okazaki fragment?
38. What happens to the mRNA during the processing that occurs directly after transcription?
39. What is the flow of information from a gene to a working cell component?
40. What is a silent mutation?

Chapter 25 Molecular Inheritance
TGT Answers
1. Many places at the same time
2. Unzips the DNA molecule.
3. It carries patterns for protein synthesis from the nucleus to the cytoplasm.
4. The portion of tRNA that binds with mRNA
5. The 5’ to 3’ strand of DNA
6. A segment of DNA that can “jump” between chromosomes.
7. A nucleotide.
8. Double helix.
9. tRNA
10. 5 carbon sugar, phosphate, nitrogen base
11. Each DNA molecule consists of one “old” strand and one “new” strand.
12. Repair enzymes
13. 2
14. They remove introns from RNA
15. Point
16. Identical sister chromatids, 2 strands of DNA
17. RNA is created using a DNA pattern
18. Promoter.
19. Translation
20. RNA
21. Mutation
22. Joins nucleotides together on the lagging strand of DNA
23. 60
24. TAA
25. RNA
26. Initiation, elongation, termination
27. DNA nucleotides are arranged in a different sequence.
28. 3
29. Peptide bonds
30. Hydrogen bonds
31. DNA was the genetic material that transforms bacteria
32. That DNA and not protein are passed to one’s offspring.
33. On the outside of the double helix.
34. Cytosine
35. Gene
36. Both the nucleus and the cytoplasm.
37. The part of an RNA molecule that actually gets made into a protein
38. Encourages cell growth by triggering different phases of the cell cycle
39. 5’-3’
40. DNA Polymerase
41. The amount of Adenine and Thymine were equal and the amount of Cytosine and Guanine are equal.
42. That something was being passed from 1 cell to another to cause transformation
43. 3
44. Small pieces of DNA built on the lagging strand
45. Fragments, no
46. RNA has ribose, DNA has deoxyribose; RNA is single stranded, DNA double; RNA has uracil instead of thymine
47. RNA polymerase
48. Introns are removed and the exons are spliced together, making the mRNA shorter
49. DNA RNA protein
50. Removes introns from mRNA
51. Change in DNA still codes for the same amino acid because there are multiple codons for every amino acid
52. Post translational control uses more energy