Jessica Joseph, Sara Austin, Sunita Bali
Unit Test: Molecular Genetics
/50 Marks
Part A: True or False (15 Marks) (K/I)
1. Adenine and guanine are pyrimidines. _____
2. The DNA double helix makes a complete turn every 3.4 nm along its length. _____
3. DNA’s backbone is held together by hydrogen bonds while the complementary bases are held
together by phosphodiester bonds. _____
4. If the deoxynucleotide sequence in one strand of a short stretch of DNA double helix is 5'–
CTGGAT–3', then the complementary sequence in the opposite strand is 3'–GACCTG–5'. _____
5. DNA helicase is an enzyme that ensures that the appropriate complementary base pairs have
been added to the growing daughter strands during DNA replication. _____
6. Joachim Hammerling’s experiment using Acetabularia revealed that the hereditary
information is found in the foot of the alga where the nucleus resides. _____
7. After one replication of double-stranded DNA, some of the daughter DNA molecules contain
no parental material. _____
8. In eukaryotes, transcription occurs in the cytoplasm and translation occurs in the nucleus.
_____
9. When a bacteria’s environment is high in lactose, the LacI protein is bound tightly to the
operator of the lac operon. _____
10. A missense mutation results in the substitution of one or more amino acids in the protein
chain. _____
11. Restriction endonucleases recognize, bind, and cut specific four to eight nucleotide
palindromic sequences of DNA. _____
12. Methylases add a methyl group to a specific recognition site, preventing the binding of the
respective restriction enzyme. _____
13. Gel electrophoresis separates DNA fragments according to charge. The larger the fragment,
the larger the charge it will carry because of the presence of more phosphate groups. _____
14. Restriction fragment length polymorphism is highly discriminating because it targets
polymorphic regions of DNA. _____
15. The polymerase chain reaction makes a large number of copies of the entire genome. _____
Jessica Joseph, Sara Austin, Sunita Bali
Part B: Multiple Choice (15 Marks) (K/I)
16. Which of the following best describes deoxyribonucleic acid (DNA)?
a. It consists of a linear backbone of the sugar deoxyribose and phosphates, with nitrogenous
bases attached to the sugar residues.
b. It consists of a linear backbone of sugar and bases, with a phosphate group attached to each
base.
c. It consists of a linear backbone of phosphates and bases, with a sugar group attached to each
end.
d. It is a double helix when present in single-stranded form.
e. It consists of a linear backbone of the deoxyribose sugar.
17. Which of the following is associated with only the lagging strand during DNA replication?
a. RNA primers
b. DNA polymerase I
c. DNA polymerase III
d. Okazaki fragments
e. DNA gyrase
18. The percent composition of adenine in a DNA molecule is found to be 35%. Therefore,
which of the following is the percent composition of guanine?
a. 35%
b. 30%
c. 15%
d. cannot be determined
e. depends on the species
19. Which of the following did Matthew Meselson and Franklin Stahl’s experiment illustrate?
a. DNA is the hereditary material.
b. DNA is found in the nucleus.
c. DNA replicates semiconservatively.
d. DNA replicates conservatively.
e. DNA is composed of a deoxyribose sugar, a phosphate group, and a nitrogenous base.
20. Which of the following primers, used with PCR, would allow copying of the single-stranded
DNA sequence 5'-ATGCCTAGGTC-3'?
a. 5'-ATGCC-3'
b. 5'-TACGG-3'
c. 5'-CTGGA-3'
d. 5'-GACCT-3'
e. 5'-GGCAT-3'
21. Which of the following tools of recombinant DNA technology is incorrectly paired with its
use?
a. restriction endonuclease: the production of gene fragments for gene cloning
b. DNA ligase: an enzyme that cuts DNA, creating sticky ends
Jessica Joseph, Sara Austin, Sunita Bali
c. Taq polymerase: copies DNA sequences in the polymerase chain reaction
d. electrophoresis: separates DNA fragments according to size
e. plasmid: a vector that introduces foreign genes into bacterial cells
22. Which of the following best describes antisense oligonucleotides?
a. They are used to promote the expression of a specific gene.
b. They are found only in bacterial DNA.
c. They hybridize to mRNA and prevent ribosomes from translating the mRNA into protein.
d. They can be used to introduce foreign DNA into living cells.
e. none of the above
23. The restriction enzyme BamHI was purified from which of the following?
a. E. coli
b. lambda bacteriophage
c. human cells
d. Bacillus amyloliquefens
e. bovine amniotic cells
24. The anticodons of arginine, serine, and tyrosine are GCA, UCA, and AUA, respectively. If a
segment of DNA codes for these three amino acids in the sequence listed (arginine, serine,
tyrosine), which of the following would be the sequence of deoxyribonucleotides of the strand of
the DNA molecule that coded for these amino acids?
a. GCATCAATA
b. CGUAGUUAU
c. CGATCTAUA
d. GCAUCAAUA
e. CGTUCAAUA
25. Base-pair substitutions involving the third base of a codon may not result in an error in the
polypeptide. What is partly responsible for this avoidance of error?
a. Base-pair substitutions are corrected before transcription begins.
b. Base-pair substitutions are restricted to introns, and these regions are later deleted from the
mRNA.
c. Most tRNAs bind tightly to a codon with only the first two bases of the anticodon.
d. A signal-recognition particle corrects coding errors before the mRNA reaches the ribosome.
e. Transcribed errors attract spliceosomes which then stimulate splicing and correction.
26. What does an operon typically consist of?
a. an operator, a promoter, and a cluster of genes
b. a cluster of genes
c. a promoter and a cluster of genes
d. an operator and a cluster of genes
e. a promoter and an operator
27. Which of the following are the enzymes involved in posttranscriptional modification?
a. RNA polymerase and spliceosomes
Jessica Joseph, Sara Austin, Sunita Bali
b. RNA polymerase and poly-A polymerase
c. poly-A polymerase and spliceosomes
d. RNA polymerase, poly-A polymerase, and spliceosome
e. none of the above
28. Which of the following best describes ribonucleic acid (RNA)?
a. composed of a linear backbone of sugar deoxyribose and phosphates with amino acids
attached to the sugar residues
b. identical to DNA except that the base uracil is present instead of the base thymine
c. identical to DNA except that the sugar ribose is present instead of the sugar deoxyribose
d. identical to DNA except that it is always single stranded, whereas DNA is always found as a
double helix containing two strands
e. similar to DNA but it contains ribose in place of deoxyribose and uracil instead of thymine
29. What does the central dogma specify?
a. A DNA sequence encodes an RNA sequence that encodes protein.
b. An RNA sequence encodes protein that encodes DNA.
c. RNA plays a major role in gene expression.
d. Genes are encoded in the nucleus.
e. RNA sequences encode DNA, which encode proteins.
30. What does the base sequence AAU GGC code for?
a. one specific amino acid, followed by a nonsense codon
b. two enzymes
c. two specific amino acids
d. three nucleotide base pairs
e. one enzyme and one specific amino acid
Part C: Short and Long Answer Questions (20 Marks) (K/I/C/A)
Knowledge/Understanding (2 Marks each)
1) Using a diagram, illustrate how the two DNA strands in a double helix run antiparallel. Make
sure to show the different parts of the backbone and the base pairing. Also remember to label the
ends of the backbone.
2) Calculate how many copies of an original DNA strand would be synthesized after 20 cycles of
PCR. Explain and show your work.
Inquiry (pick one) (3 Marks each)
3) Draw a diagram of a 4627-base-pair plasmid that has the following features:
a) a single EcoRI site
b) a single BamHI site
c) two fragments, 1735 base pairs and 2892 base pairs, from EcoRI/BamHI digestion
d) an antibiotic-resistance gene on the smaller fragment
Jessica Joseph, Sara Austin, Sunita Bali
4) Sukiyo wants to analyze a fragment of DNA for what possible protein sequences it might
encode – there are three possibilities, depending where she starts, as she knows that this DNA
sequence is not at the beginning of the gene, and is not sure how the codons line up. What are the
three possible protein combinations? Show your work.
DNA fragment sequence:
5’ – GACGACCACCAGATCCAAGAAACCGACAAGTT – 3’
Communication (pick one) (3 Marks each)
5) DNA is the hereditary material of all life. Comment.
6) Create a table that could be used by others to distinguish between the various types of RNA
and their roles in transcription and translation.
Application (pick one) (10 Marks)
7) “The government should ban genetically modified foods”. Write an extended response
supporting or refuting the statement.
8) Discuss at least three practical applications of DNA research in everyday life.
Jessica Joseph, Sara Austin, Sunita Bali
Jessica Joseph, Sara Austin, Sunita Bali
ANSWER KEY
Part A: True or False
1. F
2. T
3. F
4. F
5. F
6. T
7. F
8. F
9. F
10. F
11. T
12. T
13. F
14. T
15. F
Part B: Multiple Choice
16. a
17. d
18. c
19. c
20. e or d
21. b
22. c
23. d
24. a
25. c
26. a
27. c
28. e
29. a
30. c
Jessica Joseph, Sara Austin, Sunita Bali
Part C: Short and Long Answer Questions
1) Diagrams should be variations of the one below.
2) Since each cycle of PCR produces two new copies from one DNA strand, the growth is
exponential. Therefore, after 20 cycles, the number of copies synthesized would be:
220 = 1.05 x 106
3)
4)
DNA
RNA
PROTEIN
5’ GACGACCACCAGATCCAAGAAACCGACAAGTT 3’
3’ CU GCU GGU GGU CUA GGU UCU UUG GCU GUU CAA5’
Asn-Leu-Ser-Val-Ser-Trp-Ile-Trp-Trp-Cys
DNA
RNA
PROTEIN
5’ GACGACCACCAGATCCAAGAAACCGACAAGTT 3’
3’ C UGC UGG UGG UCU AGG UUC UUU GGC UGU UCA A 5’
Thr-Cys-Arg-Phe-Leu-Gly-Ser-Gly-Gly-Arg
DNA
RNA
PROTEIN
5’ GACGACCACCAGATCCAAGAAACCGACAAGTT 3’
3’ CUG CUG GUG GUG UAG GUU CUU UGG CUG UUC AA 5’
Leu-Val-Gly-Phe-Leu-Asp-Val-Val-Val-Val
Jessica Joseph, Sara Austin, Sunita Bali
5) DNA molecules contain instructions for building every living organism on Earth. DNA is a
macro-molecule that consists of repeating units, called nucleotides. Nucleotides are made up of a
sugar molecule, a phosphate and one out of four nitrogenous bases (Adenine, Thymine, Guanine,
Cytosine). The sequence of the nitrogenous bases determines the proteins encoded by a particular
DNA segment. The sequences are different for all living organisms but the composition of DNA
remains the same. Thus, DNA forms the basis of all life on Earth.
6)
Type of RNA
messenger RNA (mRNA)
transfer RNA (tRNA)
ribosomal RNA (rRNA)
Key functions
- acts as the intermediary between DNA and
the ribosomes
- translated into proteins by ribosomes
- functions as the delivery system of amino
acids to ribosomes as they synthesize proteins
- binds with proteins to form the ribosomes
7) and 8) – Answers will vary
References
Di Giuseppe et al., (2003) Biology 12. Toronto: Nelson