Shedding of Mycobacteriumavium subspecies
paratuberculosis bacteria by natural infected dairy
calves before first calving
Research Project Veterinary Medicine University Utrecht
Ronald Wester
3383504
22/7/2013
Project Tutors:
University of Calgary:
Universiteit Utrecht:
Herman Barkema
Robert Wolf
Susanne Eisenberg
Contents
Summary .................................................................................................................................... 4
Introduction ................................................................................................................................ 5
Material and Methods ................................................................................................................. 8
Herd selection and sample collection ..................................................................................... 8
Laboratory procedures ............................................................................................................ 8
DNA Extraction.................................................................................................................. 8
qPCR .................................................................................................................................. 9
Amplification reaction........................................................................................................ 9
Statistical analysis .................................................................................................................. 9
Results ...................................................................................................................................... 10
Discussion ................................................................................................................................ 11
Conclusion ................................................................................................................................ 13
References ................................................................................................................................ 14
2
3
Summary
Mycobacterium avium subspecies paratuberculosis (MAP) is the causal agent of Johne’s
disease. Most on farm control measurements against the spread of MAP aim to reduce the
transmission between cow and calf. This research focusses on the spreading of MAP between
young stock on infected farms. The aim of the study was to determine the proportion of young
stock shedding viable MAP bacteria on infected farms and to determine the agreement
between the two PCR methods used. 13 known infected farms were included in the research.
Fecal samples were taken from the rectum of all young stock before first calving. Bull calves
present on the farm were included. 2122 samples were analyzed by qPCR, using primers
targeting the MAP specific IS900 and F57 sequences in two different runs. 147 (6,9%)
samples were positive on IS900 PCR and 31 (1,5%) samples were positive on F57 PCR. 11
samples (0,5%) were positive on both target genes. The agreement beyond chance between
IS900 and F57 was poor (κ=0.102).
4
Introduction
Mycobacterium avium subspecies paratuberculosis (MAP) is the causal agent of Johne’s
disease and causes a chronic contagious granulomatous enteritis1. MAP is a gram-positive,
acid-fast, intracellular bacterium and is more resistant to physical factors such as cold, heat,
and dryness then most other vegetative bacteria. It can be viable in the environment for up to
1 year in cool temperatures and sufficient humidity1,2. Paratuberculosis has very large
financial consequences for the dairy farm industry. These consequences are caused by
reduced milk yield, poor fertility, reduced slaughter value and premature culling. Losses for
the Canadian dairy industry caused by Johne’s disease are estimated over 15 million Canadian
dollars annually3. No treatment is currently available4. MAP is also associated with Crohn’s
disease in humans. A causal role of MAP in the etiology of Crohn’s disease can neither be
confirmed nor excluded with certainty5.
Common understanding is that most infections with MAP occur during the perinatal period by
fecal-oral contamination between adult and susceptible youngstock1,6. On a later age calves
require higher doses of MAP to cause an infection that leads to later onset of clinical signs1.
In utero infection occurs in about 9% of fetuses from sub clinically infected cows and 39% of
fetuses from clinically affected cows7. Calves can also get infected by aerosols via the
respiratory route8.
When a susceptible animal ingests MAP bacteria, MAP makes its way to the small intestine
and settles in the Peyer’s patches in the gut wall of primarily the ileum1, 9. After entering the
gut wall through M cells, the bacteria is phagocytized by macrophages9. Inside the
macrophages MAP resists toxic and enzymatic degradation and multiplies until the
macrophage ruptures and the bacteria spread to other nearby cells10. Eventually the
macrophages spread to the regional lymph nodes where the bacteria can stimulate
inflammatory and immunological responses9. The organism proliferates slowly in the
macrophages that is why the incubation period of MAP is very long, 2 to 3 years, but can be
up to 10 years1, 9, 11.
MAP infection occurs in 4 different stages; the silent infection, the subclinical infection, the
clinical infection and the advanced clinical infection. The silent infection generally includes
young stock up to 2 years of age but can last up to 10 years12. During this stage there are no
signs of infection and no measurable subclinical effects of infection. Animals in the silent
infection may shed MAP in their feces but in very low quantities and intermittently.
Quantities of MAP in feces of animals in the first infection stage are low13.
In the subclinical stage of infection the concentration of MAP in the intestinal tissues are
increasing. During this stage the animal has an altered immune response. T cells produce
higher quantities of gamma interferon to specific mitogens and antibody response is
increased14. Most animals in the second stage of infection shed MAP in their manure,
contaminating their environment and act as source of infection to other animals12. The rate of
disease progression through the second stage of infection is very variable. Many second stage
infected animals will be culled from the herd earlier because of reasons unrelated to
documented MAP infection, such as reduced milk yield, mastitis, infertility or lameness15.
Animals in the clinical infection stage suffer from diarrhea and gradual weight loss. Vital
signs like heart rate, respiratory rate, temperature and appetite are normal. Intermittent
diarrhea is often present for weeks. Milk production drops as emaciation and cachexia
develop gradually. Nearly all cattle in the third stage of infection are faecal culture positive
5
and are shedding high concentrations of MAP in their faeces. Cattle in this stage mostly are
culled from the herd after a few weeks because of unresponsive diarrhea, decreased milk
production and weight loss12.
In the advanced clinical stage cattle become increasingly lethargic, emaciated and weak.
Profuse diarrhea, so called “water-hose” or “pipestream” diarrhea is typical for this stage.
Intermandibular oedema and hypoporoteinemia are also very common. Progress from the
second stage to the fourth can go within a few weeks. At the end of the last stage animals
become anemic, cachectic and too weak to rise. The animal will die because of dehydration
and cachexia1,12.
There are different ways to diagnose MAP infection, including PCR, culture, agar gel
immunodiffusion (AGID) and enzyme linked immune sorbent assay (ELISA). PCR and
culture are methods that identify the organism, ELISA and AGID identify an immunological
reaction against the organism9. The detection methods used to diagnose MAP suffer from less
than ideal sensitivity; this is especially a problem in the early stage of infection, when
antibody titers in infected animals are low16.
ELISA on serum don’t have very high sensitivity. The estimated sensitivity on low shedders
was 12% or 15%, in high shedders the sensitivity was 75%. Specificity is much higher with
96.8% 17, 18. Faecal culture also has a very high specificity, approaching 100%. The sensitivity
of fecal culture is high for clinical cows19. However in testing low shedding cows sensitivity
of fecal culture is only 19%20.
PCR techniques have a sensitivity that is lower than culture27. IS900 and F57 are two often
used gene targets. IS900 has the highest sensitivity because it is an insertion sequence that has
multiple copies in the MAP genome. In the MAP genome there are 15-20 copies of IS90021.
However, the specificity of IS900 is not that high because of the presence of IS900 like
sequences in related mycobacterial species21. This can cause false positive results. The F57
target sequence has only one copy in the MAP genome and has only been found in MAP. This
makes the F57 very specific but also less sensitive because of the one copy22,23,24.
Infections with MAP in dairy cattle have been described all over the world. Only Western
Australia and Sweden claim to be free from MAP infection in their population of dairy cattle.
In other countries published herd estimates range from 7% (Austria) to 55% (The
Netherlands) 25. In Canada seroprevalence at animal level in dairy cattle range from 1.3% in
Prince Edward Island to 7.0% in Alberta. 9.8% of herds in Ontario were positive to 40.0% to
58.8% of herds in Alberta9, 26.
Because of the low sensitivity and specificity, testing and culling is insufficient for the control
of MAP. That is why the main focus of prevention is based on management interventions. The
main focus of control programs are to decrease calf exposure to all feces by the
implementation of best hygiene practices, and to reduce the number of animals that
contaminate the environment by shedding MAP bacteria in their manure9. These practices
usually mean separation of calf and dam as soon as possible, separate housing of young stock
and adult cattle and culling of shedding animals. The control programs help to decrease the
prevalence of MAP, but don’t eradicate it27. This indicates that the implemented measures
don’t control all MAP transmission routes6. To quantify the importance of recommendations
related to minimize calf exposure to infected manure is challenging because calves can
become exposed to infected manure by many possible ways, and there is a long interval
6
between exposure and detectable disease. Universally accepted is that poor manure
management, poor hygiene and contact of susceptible animals with manure of infected
animals lead to exposure and infection in JD infected herds28.
Van Roermund et al. (2007) showed that calves can transmit MAP infection to other calves in
experimental conditions29. Objectives of this study were to determine the number of young
stock shedding MAP bacteria in different age groups on MAP infected dairy farms to see if
there is a potential of calf to calf transmission in practical circumstances on dairy farms in
Alberta. The second objective was to determine the agreement between the two PCR methods
used.
7
Material and Methods
Herd selection and sample collection
The dairy farms selected for the research were situated in Alberta, Canada. They all had
positive environmental samples. On all participating farms rectal fecal samples of all female
calves and heifers before first calving were taken. Bull calves under 24 months of age were
included if present on the farm. Samples were taken during June, July and August 2013. Fecal
samples were taken using rectal exploration gloves and lubricant. A total of 2122 samples
were taken and processed, birth dates of 1919 animals were recorded. The samples were
stored in labeled zip lock bags. In the laboratory, the samples were stored in refrigerators at a
temperature of 4° Celsius until they were processed.
Laboratory procedures
DNA Extraction
In the lab samples were processed to extract DNA. For the DNA extraction the MagMAX™
total Nucleic Acid Isolation Kit by Ambion® was used. To start the extraction of the DNA,
0.3 gram of every sample was added to 1 ml of PBS in a 1.5 ml Eppendorf tube. The tubes
were vortexed for 30 seconds. After vortexing the tubes were centrifuged for 1 minute at 100
x g. 235 µL of Lysis/Binding Solution was added to a Bead tube and, 175 µL supernatant of
the 1.5 ml cup was transferred to the Bead tube. The Bead tubes were bead beated twice for 5
minutes in a Biospec products, inc. Mini-beadbeater™ with a period of 5 minutes resting in
ice in between. Then the beat tube was centrifuged at 16.000 x g for 3 minutes and the
supernatant was transferred to an empty 1.5 ml tube. 115 µL of sample was transferred to a
well of a processing plate. 65 µL of 100% isopropanol was added and mixed for 1 minute.
After shaking, 20 µL of bead mix was added to the sample and was shaken for another 5
minutes to bind the nucleic acid to the binding beads. The processing plate was moved onto a
magnetic stand to capture the nucleic acid binding beads. When after 4 minutes the capture
was completed, the supernatant was aspired and discarded. 150 µL of Wash Solution 1 was
added and the plate was shaken for 1 minute. Then the plate was placed on the magnetic stand
again and the supernatant was aspirated and discarded. Again 150 µL of Wash Solution 1 was
added, the plate was shaken for 1 minute and the supernatant was discarded. After the wash
steps with wash solution 1, the same steps where undertaken twice adding 150 µL of Wash
Solution 2 instead of Wash Solution 1. The plate was moved on to the shaker and was shaken
for 2 minutes to allow any remaining alcohol to evaporate. Then 20-50µL of the 65ºC Elution
Buffer was added to each sample. The samples were shaken for 3 minutes to resuspend the
nucleic acid. The processing plate was placed on the magnetic stand to capture the NA
Binding Beads. The supernatant containing the purified nucleic acid was transferred to a clean
processing plate and stored at -20ºC, ready for the PCR procedure.
8
qPCR
IS 900
The oligonucleotide primers used for the IS900 rtPCR have been described by Slana et al.30
(table 1). The primers that have been used are designed to amplify a 145-base-pair target
sequence that can be detected with the PCR probe sequence.
Table 1: IS900 primers and probes
Type
Name
Sequence
Probe
IS900qPCRTM
ATTGGATCGCTGTGTAAGGACACGT
Forward
IS900qPCRF
GATGGCCGAAGGAGATTG
Reverse
IS900qPCRR
CACAACCACCTCCGTAACC
F57
The oligonucleotide primers and probe used for the F57 rtPCR have been described by Slana
et al.30(table 2). The primers that have been used are designed to amplify a 147–base-pair
target sequence that can be detected with the PCR probe sequence.
Table 2: F57 primers and probes
Type
Name
Sequence
Probe
F57qPCRTM
CAATTCTCAGCTGCAACTCGAACACAC
Forward
F57qPCRF
GCCCATTTCATCGATACCC
Reverse
F57qPCRR
GTACCGAATGTTGTTGTCAC
Amplification reaction
The amplification for the IS900 and F57 rtPCR was carried out in a Bio-Rad CFX96™ Real
Time PCR System. A mixture with a total volume of 20 µL was used for the reaction. The 20
µL contained 10 µL of TaqMan fast advanced master mix (Applied Biosystems™), 1 µL of
forward primer, 1 µL of reverse primer, 1 µL of IS900 or F57 probe, 1 µL Internal Control
probe, 2 µL of Internal Control plasmid, 2µL of Dnase- Rnase- free water and 2µL of the
samples DNA lysate. The following PCR cycle was used; the first step was the pre-incubation
step, for 2 minutes at 50ºC. This was followed by the denaturation step at 95ºC for 20
seconds. Then there were 40 repeats of 95ºC for 3 sec and 61ºC for 30 sec. After each repeat
the fluorescence reading is made. The repeat cycles were followed by the final extension with
95ºC for 1 minutes and 72ºC for 5 minutes. For IS900 a ct (crossing point of the amplification
curve with the preset threshold of fluorescence detection) cut off value of 37.00 was used and
for F57 no ct cut off value was used and any signal was interpreted as a positive sample.
Statistical analysis
The statistical analysis was performed using IBM SPSS statistics 20 software. The prevalence
of positive IS900 and F57 samples is calculated for all 13 farms. To estimate the agreement
between the IS900 and F57 results, the total prevalence from both tests were compared using
a Cohen’s kappa and controlled with the 95% confidence interval. Prevalence of IS900 and
F57 of the 13 farms were used to calculate the mean prevalence. T-tests of both IS900 and
F57 mean prevalence per farm were used to calculate the 95% confidence intervals. The
9
animals with a known birth date were divided into 4 age groups, and the prevalence of IS900
and F57 positive animals per age group was calculated. The association between age group
and IS900 or F57 positive animals was tested by using Pearson Chi-Square test. Phi and
Cramer’s V tests were used to measure the strength of association.
Results
2122 samples were processed in total. 147 (6,9 %) samples were positive on IS900 PCR and
31 (1,5 %) samples were positive on F57 PCR and of those samples 11 (0,5 %) were positive
on both target genes. The number of calves tested by herd and the prevalence of IS900 and
F57 positives is summarized in Table 1.
Table 3: number of calves tested by herd with prevalence of samples positive on IS900 and F57 PCR.
Herd Tested
N IS900 positive (%)
N F57 positive (%)
N Positive IS900+F57 (%)
1
282
12 (4,3)
2 (0,7)
2 (0,7)
2
213
20 (9,4)
14 (6,6)
6 (2,8)
3
218
23 (10,6)
7 (1,5)
1 (0,5)
4
161
2 (1,2)
0 (0)
0 (0)
5
225
5 (2,2)
2 (0,9)
1 (0,4)
6
200
22 (11)
1 (0,5)
0 (0)
7
111
20 (18)
1 (0,9)
0 (0)
8
160
12 (7,5)
1 (0,6)
1 (0,6)
9
117
4 (3,4)
3 (2,6)
0 (0)
10
77
2 (2,6)
0 (0)
0 (0)
11
122
3 (2,5)
0 (0)
0 (0)
12
202
22 (10,9)
0 (0)
0 (0)
13
34
0 (0)
0 (0)
0 (0)
Total
2122
147 (6,9)
31 (1,5)
11 (0,5)
In 12 of the 13 herds IS900 positive calves were present; the negative herd was the smallest
herd with only 34 animals tested. In F57 results 8 out of the 13 herds had one or more positive
animals in the herd. Prevalence of F57 positive calves in the herds varied from 0% to 6,6%.
The variation in prevalence of IS900 positive calves varied more, 0% in herd 13 to 18% in
herd 7. The herd with the highest prevalence of IS900 positive calves did not have the highest
prevalence of F57 positive calves. The agreement between IS900 and F57 was the best in herd
2, with 6 samples positive on both the IS900 and F57 test. Mean prevalence of IS900 positive
calves in the 13 herds was 6,4% with a standard deviation of 5,3. The 95% confidence interval
of the difference ranged from 3,25% to 9,61%. The mean prevalence of F57 positive calves in
the 13 herds was 1,1%. With a standard deviation of 1,8. The 95% confidence interval of the
difference ranged from 0,003% to 2,197%. The Pearson Chi-Square test showed no
association between age group and IS900 or F57 positives.
10
Table 4: Results of IS900 and F57 per age group.
Age group
0-182 days
183-365 days
366-547 days
548< days
Total
Total animals
458
471
456
534
1919
N positive
28
27
34
44
133
IS900
%positive
6,1
5,7
7,5
8,2
6,9
Table 5: Summary of agreement between IS900 and F57 results.
F57
Negative
Positive
IS900
Negative
1955
20
Positive
136
11
Total
2091
31
F57
N positive
9
5
8
6
28
% positive
2,0
1,1
1,8
1,1
1,4
Total
1975
147
2122
The agreement on positive samples was 11 and the agreement on negative samples was 1955.
So the total agreement was 1966 and 1945.5 by chance. The kappa (κ=0.102) was poor with
the interval of confidence of (-0.01, 0,25). The agreement between the IS900 and F57 results
is poor.
Discussion
This study showed the presence of MAP in the feces of young stock in 13 dairy herds with
MAP positive environmental samples. There are differences between prevalence of IS900 and
F57 positive calves between these herds. In this study the agreement of the PCR tests was
poor. The prevalence of F57 positive animals that was found in this study was similar to the
results that Antognoli et al. (2007) found in their study. They determined the proportion of 8month-old calves that was shedding MAP in feces by culture and One Tube Nested
Polymerase Chain Reaction (OTSN-PCR) and found that approximately 3% of the calves
were shedding MAP in their feces31. Bolton et al (2011) used liquid culture as detection
method and sampled 1202 animals varying in age from 0 to 24 months in herds with
confirmed diagnosis of JD in adult cows, the analyzed 1842 fecal samples and found 27
animals (2%) positive32.
The prevalence of IS900 and F57 positive animals varied significantly between farms, with
the highest IS900 prevalence (11%) in herd one and no positive animals in herd 11. The
results of the F57 prevalence also varied significantly. Those differences could be caused by
several factors. All 13 farms had at least one positive environmental sample in the past. That
is how they were selected, but we don’t know the adult cow within herd prevalence. There
could be a variation of infection of the adult herd between the farms. If there are more adult
animals infected and in an advanced stadium of the infection, the chance of finding infected
and shedding calves would be higher. Bolton et al. (2011) found that an adult herd MAP
seroprevalence of more than 10% was associated with heifers being MAP fecal culture
positive32. With heavy environmental MAP contamination there is also the chance of
detecting passive shedders. Super shedders are MAP infected animals that show no clinical
disease but shed high concentrations of MAP bacteria in the environment. When a super
11
shedder is present in a herd, ingestion of only 5 ml of manure contamination in forage can
result in passive shedding. It is suggested that in a herd where a super shedder is present, this
could cause 50 % of all culture positive cattle1. This could be a risk for the animals in the
older age groups, because at a few farms dry cows and sampled animals were housed close to
each other.
Another reason for the varying results on IS900 and F57 positive animals between farms
could be a variation in age distribution in the different tested herds. Although in this research
no association between age group and IS900 or F57 positive animals was found, Bolton et al.
(2011) found that an age of more than 6 months was one of the risk factors for the shedding of
MAP32. Calves that are infected perinatal can progress from stage I to stages III and IV in 1 to
3 years. Animals in this stage shed higher numbers of MAP bacteria12 so it is more likely that
those animals are detected. The disease progress is accelerated in animals that are frequently
exposed to high doses of MAP on a young age, these animals can develop clinical signs and
starts shedding on a young age32.
The agreement between IS900 and F57 prevalence was poor in this study. The extraction
method can’t be a factor here because we used the same procedure for all samples. The
sample DNA lysate for the different amplification reactions was taken from the same sample.
The extraction kit that was used had good results in a comparison of DNA isolation kits (76%
identification of positive samples with the use of IS900)33. This cannot explain the difference
in prevalence but the difference in specificity and sensitivity is an explanation for differences.
In general PCR analysis has high sensitivity and specificity23, 24, 33. Slana et al. (2008) found
similar specificity for the IS900 and F57 primers we used. To evaluate the specificity of the
qPCR assays, they studied the possible cross-reactions with 16 selected mycobacterial, nonmycobacterial and mammalian species30. In two different papers the primers based on IS900
by Vary et al. (1990)36 are criticized for their lack of specificity compared to other IS900
primers 24, 35. The use of the primers IS900/150 and IS900/921 resulted in false positive
products for DNA by the cause of M. foruitum, M. intracellulare and Salmonella
Typhimurium. Also there were found DNA byproducts of different mycobacteria species and
other bacteria24, 35. Slana et al. (2008) tested the cross-reactions of the 16 selected species, but
M. foruitum is not in that selection. M. foruitum and other bacteria can be a factor in the
difference in positive samples between IS900 and F57. The presence of those bacteria on the
farms could influence the differences between the farms.
PCR protocols based on the F57 gene have a high specificity23, 24, 35. There are some
conflicting results about the sensitivity in other reports, Kawaji et al. (2007) found that PCR
based on F57 had lower sensitivity than PCR based on IS900 due to lower F57 copy numbers
in the genome23. Möbius et al. (2008) found similar sensitivity between IS900 and F57
rtPCR24.
12
Conclusion
Of the 2122 samples tested 147 (6,9%) samples were positive on IS900 PCR and 31 (1,5%)
samples were positive on F57 PCR. Only 0.5% of the samples were positive on both PCR
tests. It can be assumed that a proportion of the IS900 positive samples are false positive for
MAP24, 35. In almost all herds positive animals were found, therefore we conclude that MAP
excretion by calves is most likely a transmission pathway. The agreement between both tests
was poor κ=0.102. To explain the differences in prevalence of PCR positive animals between
the farms, more data is needed about the rate of infection in the rest of the herd. Also the age
of the animals should be taken in consideration. We can conclude that positive IS900 PCR
samples should be confirmed by subsequent sequencing or by a PCR assay targeting different
DNA sequence in MAP35.
13
References
1
Divers, Peek; Diseases of Dairy Cattle; 2008 Elsevier
2
M. T. Collins; Diseases of Dairy Animal, Infectious Diseases: Johne’s Disease; 2002 Elsevier.
3
Mc Kenna et al.; Johne’s disease in Canada part II: Disease impacts, risk factors, and control
programs for dairy producers; Can Vet J 2006;47:1089–1099.
4
Marcé et al.; Invited review: Modeling within-herd transmission of Mycobacterium avium
subspecies paratuberculosis in dairy cattle: A review; J. Dairy Sci. 2010; 93:4455-4470.
5
Feller et al.; Mycobacterium avium subspecies paratuberculosis and Crohn’s disease: a
systematic review and meta-analysis; Lancet Infect Dis 2007; 7:607–13.
6
Eisenberg et al.; Whitin-farm transmission of bovine paratuberculosis: recent developments;
Veterinary Quarterly 2012; 32:31-35.
7
Whittington, Windsor; In utero infection of cattle with Mycobacterium avium subsp.
Paratuberculosis: A critical review and meta-analysis; The Veterinary Journal 2009;170:6069.
8
Eisenberg et al.;Intestinal infection following aerosol challenge of calves with Mycobacterium
avium subspecies paratuberculosis; Veterinary Research 2011; 42:117.
9
Tiwari et al.; Johne’s disease in Canada part I: Clinical symptoms, pathophysiology,
diagnosis, and prevalence in dairy herds; Can Vet J 2006; 47:874–882.
10 Tessema et al.; Bacteriology: Review paratuberculosis: How does mycobacterium avium
subsp. Paratuberculosis resist intracellular degradation; Veterinary Quarterly 2001; 23:15362.
11 Feller et al.; Mycobacterium avium subspecies paratuberculosis and Crohn’s disease: a
systematic review and meta-analysis; Lancet Infect Dis 2007; 7:607–13.
12 Behr MA, Collins DM. Paratuberculosis: Organism, Disease, Control. : CABI; 2010.
13 Waters et. al; Early Induction of Humoral and Cellular Immune Responses during
Experimental Mycobacterium avium subsp. Paratuberculosis Infection of Calves; Infection
and Immunity, Sept. 2003; 5130–5138.
14 Bassey, E.O. and Collins, M.T.;Study of Tlymphocyte subsets of healthy and Mycobacterium
avium subsp. paratuberculosis-infected cattle. Infection and Immunity 1997; 65:4869–4872.
15 Merkal et. al; Analysis of the effects of inapparent bovine paratuberculosis. American Journal
of Veterinary Research 1975; 36: 837–838.
16 Collins et. al; Consensus recommendations on diagnostic testing for the detection of
paratuberculosis in cattle in the United States. J.Am. Vet. Med. Assoc. 2006; 229:1912–1919.
14
17 Dargatz et al; Evaluation of a commercial ELISA for diagnosis of paratuberculosis in cattle. J
Am Vet Med Assoc 2001;218:1163–1166.
18 Sweeney et.al; Evaluation of a commercial enzyme-linked immunosorbent assay for the
diagnosis of paratuberculosis in dairy cattle. J Vet Diagn Invest 1995; 7:488–493.
19 Cox et. al; Development and evaluation of a rapid absorbed enzyme immunoassay test for the
diagnosis of Johne’s disease in cattle. Aust Vet J 1991;68:157–160.
20 Sockett et. al; Evaluation of conventional and radiometric fecal culture and a commercial
DNA probe for diagnosis of Mycobacterium paratuberculosis infections in cattle. Can J Vet
Res 1992; 56:148–153.
21 Green et. al; Sequence and characteristics of IS900, an insertion element identified in a human
Crohn’s disease isolate of Mycobacterium paratuberculosis. Nucleic Acids Res 1989; 17:
9063–9073.
22 Sidoti et. al; Validation and standardization of IS900 and F57 real-time quantitative PCR
assays for the specific detection and quantification of Mycobacterium avium subsp.
Paratuberculosis. Can. J. Microbiol. 2011; 57:347–354.
23 Kawaji et al;Detection of Mycobacterium avium subsp. Paratuberculosis in ovine faeces by
direct quantitative PCR has similar or greater sensitivity compared to radiometric culture;
Veterinary Microbiology 2007; 125:36–48.
24 Möbius et. al; Comparison of 13 single-round and nested PCR assays targeting IS900,
ISMav2, f57 and locus 255 for detection of Mycobacterium avium subsp. Paratuberculosis;
Veterinary Microbiology 2008; 126:324–333.
25 Collins; Infectious Diseases, Diseases of dairy animal 2002; 2:786–792.
26 Scott et al; Seroprevalence of Mycobacterium avium subspecies paratuberculosis, Neospora
caninum, Bovine leukemia virus, and Bovine viral diarrhea virus infection among dairy cattle
and herds in Alberta and agroecological risk factors associated with seropositivity. Canadian
Veterinary Journal 2006; 47:981-991.
27 Collins et. al; Successful control of Johne’s disease in nine dairy herds: results of a six-year
field trial. J Dairy Sci. 2010; 93:1638–1643.
28 Johnson et.al; Management-related risk factors for M. paratuberculosis infection in Michigan,
USA, dairy herds. Prev Vet Med 1998; 37:41–54.
29 van Roermund et al.; Horizontal transmission of Mycobacterium avium subsp.
paratuberculosis in cattle in an experimental setting: Calves can transmit the infection to other
calves; Veterinary Microbiology 2007;122:270-279.
30 Slana et. Al; On-farm spread of Mycobacterium avium subsp. paratuberculosis in raw milk
studied by IS900 and F57 competitive real time quantitative PCR and culture examination.
International Journal of Food Microbiology 2008; 128:250–257.
15
31 Antognoli et. al; Immune Response to and Faecal Shedding of Mycobacterium avium ssp.
paratuberculosis in Young Dairy Calves, and the Association Between Test Results in the
Calves and the Infection Status of their Dams; Zoonoses Public Health. 2007; 54: 152–159.
32 Bolton et. al; Detection of Mycobacterium avium subspecies paratuberculosis in naturally
exposed dairy heifers and associated risk factors. J. Dairy Sci. 2011; 94:4669-4675.
33 Leite et al. Camparison of fecal DNA extraction kits for the detection of Mycobacterium
avium subsp. Paratuberculosis by polymerase chain reaction. Journal of Veterinary
Diagnostic Investigation 2013; 25: 27–34.
34 Cousins et al. Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis
isolated from the faeces of ruminants possess IS900-like sequences detectable by IS900
polymerase chain reaction: implications for diagnosis. Mol. Cell. Probe.1999; 13:431–442.
35 Vansnick et al; Newly developed primers for the detection of Mycobacterium avium
subspecies paratuberculosis. Veterinary Microbiology 2004; 100:197-204.
36 Vary et al.; Use of highly specific DNA probes and the polymerase chain reaction to detect
Mycobacterium paratuberculosis in Johne’s disease; Journal Clin Microbiology 1990;
28:933-7.
16