Chapter 2 Review Questions
1. Please state two types of products a gene can encode. Which of these is more
commonly studied?
2. Please state the central dogma of molecular biology. For most genes studied,
which of the molecules stated in the central dogma carries out the function of the
gene?
3. Please state the three basic steps of gene expression. At the end, what performs
the function of the gene?
4. What is the difference between a Watson strand gene and a Crick Strand Gene?
Can a stretch of DNA contain both a Watson and Crick strand gene?
5. Please draw out the structure of the gene for a Watson strand gene. In your
diagram, please add all of the appropriate structures and number the appropriate
base pairs. Also state which is the coding and which is the non-coding strand.
6. In relation to the mRNA coding region, where is the promoter found? What is the
function of the promoter?
7. As a result of transcription, is the RNA produced a mature mRNA? If not, please
state what type of RNA it is. Also, please explain what needs to happen for this RNA
to become a mature mRNA.
8. Below is a DNA molecule. The lines above and below each strand are the
transcriptional start sites.
_
5’CGATCCTAATGCCCGGATGCAGGCAATCGTATTCTTAGGTGGACATCGACGATCTGC 3’
3’GCTAGGATTACGGGCCTACGTCCGTTAGCATAAGAATCCACCTGTAGCTGCTAGACG5’
a. Please write the mRNA sequence for the Watson strand gene.
b. Please write the mRNA sequence for the Crick strand gene.
9. Please list the steps in pre-mRNA processing, and why these processing events
are important.
10. Please define the terms introns and exons. Which of these is incorporated into
an mRNA?
11. Which DNA strand does an mRNA most resemble? Please explain why this is the
case.
12. Please draw a picture of a mature RNA. Include in your diagram, each important
unit, as well as the boundaries between units. What is the function of each unit?
13. What is the definition of a codon? Include in your definition the number of
bases in a codon and what a codon encodes.
14. Please list all possible start and stop codons. Which is the most common for
each?
15. Please list the steps in how translation is initiated, and how explain them.
16. Please transcribe and translate the following gene. First, draw out the full DNA
molecule before transcribing.
5’-PCGAGACTTCATGCCCGTTTTTCCCTTGCCGAGTCGTTCAGGACCATCATAACCGCTGCAT
AATAAA -OH-3’
17. Please draw out the structure of an amino acid in the following environments.
a. In a skin cell (roughly neutral pH)
b. In the stomach (Acidic pH)
c. In the small intestine (Basic pH)
18. Please explain how a peptide bond is formed. What type of reaction needs to
occur to allow for a peptide bond to form? Are there any byproducts of this
reaction?
19. Do proteins have a speciic polarity? Please explain your answer. If so, please
state a specific category structure where polarity is important and explain why.
20. Please list all possible levels of protein structure in order from least complex to
most complex. Please briefly describe each.
21. Please state three different types of secondary structures? Which of these can
most amino acids participate in? Which one cannot? Please explain why.
22. Please describe the structure of an α-helix. Which amino acid cannot participate
as part of an α-helix? Why is this the case?
23. Please describe the structure of a β-pleated sheet? What is the difference
between parallel and antiparallel polypeptide structures with the β-pleated sheet?
24. Below are a set of proteins. For each, state which class of tertiary structure they
belong to.
Tyrosinase (enzyme)
Β-tubulin (cell structure)
G-protein receptor (transmembrane protein)
Notch Receptors
Collagen
Integrins (cell surface receptor)
Collagenase (enzyme that cleaves collagen)
25. Does Hemoglobin have quartenary structure? Please have a description of the
hemoglobin structure in your answer.
26. You are studying the B-globin gene and sickle cell anemia. Below are several
genotypes. Given the genotypes, pls. explain what phenotypes will occur, and what
proteins will be produced from the following genotypes. Additionally, how will
these affect hemoglobin quartenary structure?
i. As
ii. ss
iii. AA
27. You are studying the HD gene, which is implicated in the development of
Huntington’s Disease. In nature, there are two variants of the HD gene. The first HD
variant (H) has 300 extra CAG repeats in the region of the gene that encodes the HD
protein. Therefore, the HD protein produced has 300 extra glutamine residues, and
causes Huntington’s Disease. The other HD gene variant is the wild-type variant (h).
The H variant is dominant to the h allele.
For each of the individuals below, please state the composition of the protein(s) that
will be produced, as well as the percentage of each protein produced and whether
the individual has Huntington’s Disease.
a. HH
b. Hh
c. hh